Incidental Mutation 'R4515:Acss2'
ID332833
Institutional Source Beutler Lab
Gene Symbol Acss2
Ensembl Gene ENSMUSG00000027605
Gene Nameacyl-CoA synthetase short-chain family member 2
SynonymsAcas1, acetyl-CoA synthetase 1, Acas2, AceCS1, ACAS, Acs1
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155517948-155585724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 155556363 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 335 (L335I)
Ref Sequence ENSEMBL: ENSMUSP00000029135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029135] [ENSMUST00000065973] [ENSMUST00000103142] [ENSMUST00000133654]
Predicted Effect probably benign
Transcript: ENSMUST00000029135
AA Change: L335I

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029135
Gene: ENSMUSG00000027605
AA Change: L335I

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 1.9e-96 PFAM
Pfam:AMP-binding_C 583 661 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065973
AA Change: L335I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605
AA Change: L335I

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103142
AA Change: L348I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099431
Gene: ENSMUSG00000027605
AA Change: L348I

DomainStartEndE-ValueType
Pfam:ACAS_N 47 107 8.1e-21 PFAM
Pfam:AMP-binding 108 588 4.7e-97 PFAM
Pfam:AMP-binding_C 596 674 1.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131054
Predicted Effect probably benign
Transcript: ENSMUST00000133654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148685
Predicted Effect probably benign
Transcript: ENSMUST00000151781
SMART Domains Protein: ENSMUSP00000122545
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 1 187 1.2e-32 PFAM
Pfam:AMP-binding 187 292 1.2e-15 PFAM
Meta Mutation Damage Score 0.0960 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Acss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Acss2 APN 2 155562037 missense possibly damaging 0.83
IGL02333:Acss2 APN 2 155555884 missense probably damaging 1.00
IGL03278:Acss2 APN 2 155562001 missense possibly damaging 0.64
IGL03392:Acss2 APN 2 155562011 missense probably damaging 1.00
BB009:Acss2 UTSW 2 155573180 missense unknown
BB019:Acss2 UTSW 2 155573180 missense unknown
R1159:Acss2 UTSW 2 155551218 missense probably benign
R1293:Acss2 UTSW 2 155551221 missense probably benign
R1639:Acss2 UTSW 2 155556908 missense probably benign 0.01
R1725:Acss2 UTSW 2 155556844 missense possibly damaging 0.56
R1834:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1835:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1836:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R2361:Acss2 UTSW 2 155558669 missense probably damaging 0.98
R3899:Acss2 UTSW 2 155557237 splice site probably benign
R4008:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4009:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4010:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4011:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4031:Acss2 UTSW 2 155557210 missense probably damaging 1.00
R4117:Acss2 UTSW 2 155556393 missense probably damaging 1.00
R4756:Acss2 UTSW 2 155561143 missense probably damaging 1.00
R4895:Acss2 UTSW 2 155550481 splice site probably benign
R5327:Acss2 UTSW 2 155573229 missense probably null
R5654:Acss2 UTSW 2 155574655 unclassified probably benign
R5717:Acss2 UTSW 2 155561153 missense probably damaging 1.00
R5743:Acss2 UTSW 2 155574616 unclassified probably benign
R5773:Acss2 UTSW 2 155574694 splice site probably null
R5825:Acss2 UTSW 2 155549178 unclassified probably null
R5979:Acss2 UTSW 2 155522109 missense possibly damaging 0.75
R6525:Acss2 UTSW 2 155550417 missense probably benign
R6551:Acss2 UTSW 2 155551208 missense probably benign
R6785:Acss2 UTSW 2 155560685 missense probably damaging 1.00
R6976:Acss2 UTSW 2 155556009 intron probably null
R7074:Acss2 UTSW 2 155522041 missense possibly damaging 0.94
R7372:Acss2 UTSW 2 155557180 missense probably damaging 0.99
R7448:Acss2 UTSW 2 155518266 missense probably damaging 1.00
R7528:Acss2 UTSW 2 155557146 missense probably damaging 1.00
R7541:Acss2 UTSW 2 155574690 critical splice donor site probably null
R7543:Acss2 UTSW 2 155549835 missense probably damaging 0.98
R7754:Acss2 UTSW 2 155561166 missense probably benign 0.00
R7846:Acss2 UTSW 2 155561033 missense probably damaging 1.00
R7932:Acss2 UTSW 2 155573180 missense unknown
R8011:Acss2 UTSW 2 155555957 missense possibly damaging 0.73
Z1177:Acss2 UTSW 2 155517957 intron probably benign
Predicted Primers PCR Primer
(F):5'- TATGTGACATCAGGGTGTGGTAAAG -3'
(R):5'- AGCTTTGGGAAATGGTCACCC -3'

Sequencing Primer
(F):5'- CATCAGGGTGTGGTAAAGGAGATTG -3'
(R):5'- CCAGGAGAATTTTGTCTATGCCCAG -3'
Posted On2015-08-18