Mutagenetix > Incidental Mutation

Incidental Mutation 'R0105:Krt76'

33284

Institutional Source

Beutler Lab

Gene Symbol

Krt76

Ensembl Gene

ENSMUSG00000075402

Gene Name

keratin 76

Synonyms

2310001L23Rik

MMRRC Submission

038391-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0105 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

101884351-101892920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101884912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 564 (T564A)

Ref Sequence

ENSEMBL: ENSMUSP00000097754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100179]

AlphaFold

Q3UV17

Predicted Effect

unknown
Transcript: ENSMUST00000100179
AA Change: T564A

SMART Domains

Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: T564A

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	161	5.7e-39	PFAM
Filament	164	479	2.12e-166	SMART
low complexity region	488	551	N/A	INTRINSIC
low complexity region	565	593	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196731

Meta Mutation Damage Score

0.0744

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Krt76

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Krt76	APN	15	101884888	missense	unknown
IGL01475:Krt76	APN	15	101888513	missense	probably benign	0.11
IGL01504:Krt76	APN	15	101888173	missense	probably damaging	1.00
IGL01506:Krt76	APN	15	101892400	missense	probably damaging	0.97
IGL01943:Krt76	APN	15	101889045	missense	probably null	0.98
IGL03164:Krt76	APN	15	101887451	missense	possibly damaging	0.50
PIT4378001:Krt76	UTSW	15	101892407	missense	probably damaging	0.99
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0448:Krt76	UTSW	15	101890647	missense	probably damaging	1.00
R0730:Krt76	UTSW	15	101887349	missense	probably damaging	1.00
R0920:Krt76	UTSW	15	101892439	missense	possibly damaging	0.80
R1568:Krt76	UTSW	15	101885008	missense	unknown
R1779:Krt76	UTSW	15	101892687	missense	unknown
R1869:Krt76	UTSW	15	101889487	critical splice donor site	probably null
R1911:Krt76	UTSW	15	101888165	nonsense	probably null
R2160:Krt76	UTSW	15	101888385	missense	probably damaging	1.00
R2504:Krt76	UTSW	15	101884858	missense	unknown
R4487:Krt76	UTSW	15	101890482	missense	possibly damaging	0.71
R4729:Krt76	UTSW	15	101889081	missense	probably damaging	1.00
R4747:Krt76	UTSW	15	101885745	missense	probably damaging	1.00
R4912:Krt76	UTSW	15	101888162	nonsense	probably null
R5357:Krt76	UTSW	15	101887385	missense	probably benign	0.04
R6738:Krt76	UTSW	15	101887478	missense	probably benign	0.40
R7786:Krt76	UTSW	15	101890530	missense	probably damaging	0.98
R7808:Krt76	UTSW	15	101890494	missense	probably damaging	1.00
R7825:Krt76	UTSW	15	101887503	missense	possibly damaging	0.46
R8079:Krt76	UTSW	15	101888390	missense	possibly damaging	0.61
R8846:Krt76	UTSW	15	101887337	missense	probably damaging	1.00
R8980:Krt76	UTSW	15	101892555	missense	unknown
Z1088:Krt76	UTSW	15	101890551	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAAAGAAGTTCGGCCCCTTCTC -3'
(R):5'- TGTTACCAGCACAAGCAGCAGC -3'

Sequencing Primer
(F):5'- CACCTGTTGATGCCAAGAAGTTG -3'
(R):5'- CAAGCAGCAGCGGAAGC -3'

Posted On

2013-05-09