Mutagenetix > Incidental Mutation

Incidental Mutation 'R4515:Plekhn1'

332840

Institutional Source

Beutler Lab

Gene Symbol

Plekhn1

Ensembl Gene

ENSMUSG00000078485

Gene Name

pleckstrin homology domain containing, family N member 1

Synonyms

MMRRC Submission

041589-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R4515 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

156221456-156234857 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 156225531 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 109 (S109G)

Ref Sequence

ENSEMBL: ENSMUSP00000151799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105569] [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]

AlphaFold

Q8C886

Predicted Effect

probably benign
Transcript: ENSMUST00000105569

SMART Domains

Protein: ENSMUSP00000101194
Gene: ENSMUSG00000078485

Domain	Start	End	E-Value	Type
low complexity region	20	50	N/A	INTRINSIC
BTB	90	187	3.55e-30	SMART
BACK	192	294	1.08e-42	SMART
Kelch	341	387	4.01e-8	SMART
Kelch	388	434	5.41e-14	SMART
Kelch	435	481	6.97e-17	SMART
Kelch	482	528	1.55e-14	SMART
Kelch	529	575	2.02e-13	SMART
Kelch	576	622	1.34e-9	SMART
low complexity region	626	640	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105571
AA Change: S109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485
AA Change: S109G

Domain	Start	End	E-Value	Type
PH	96	192	4.6e-4	SMART
PH	227	324	8.34e-2	SMART
low complexity region	346	359	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105572

SMART Domains

Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486

Domain	Start	End	E-Value	Type
low complexity region	40	58	N/A	INTRINSIC
low complexity region	145	160	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	544	553	N/A	INTRINSIC
low complexity region	606	616	N/A	INTRINSIC
low complexity region	790	806	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184043

Predicted Effect

probably damaging
Transcript: ENSMUST00000217885
AA Change: S109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218699
AA Change: S109G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219227

Meta Mutation Damage Score

0.2474

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (65/68)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	G	T	5: 138,647,744	K630N	probably damaging	Het
Acss2	C	A	2: 155,556,363	L335I	probably benign	Het
Alg6	A	T	4: 99,752,786		probably benign	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Bsn	G	T	9: 108,104,078		probably null	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cdhr4	G	A	9: 107,992,951	E52K	probably benign	Het
Ces1a	T	A	8: 93,020,904	N500Y	probably damaging	Het
Chd3	G	T	11: 69,349,877	R1579S	probably benign	Het
Chrnb3	T	C	8: 27,385,090	L39P	probably damaging	Het
Ckm	A	G	7: 19,420,284	K319E	probably damaging	Het
Cnot6	C	T	11: 49,702,536		probably null	Het
Copg1	A	G	6: 87,907,546		probably benign	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnah2	A	G	11: 69,465,631	S2135P	possibly damaging	Het
Dsg2	C	A	18: 20,601,387	D807E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxi1	A	G	11: 34,207,972	F18L	probably damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Glod4	T	A	11: 76,243,571	D25V	probably damaging	Het
Gm11492	A	G	11: 87,568,057	H419R	probably benign	Het
Gm9008	C	T	6: 76,496,809	V275I	probably benign	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
H2-M10.3	C	T	17: 36,367,830		probably null	Het
Hemgn	T	C	4: 46,396,477	E253G	probably damaging	Het
Itsn1	G	A	16: 91,899,649	V47M	probably damaging	Het
Kif5b	A	G	18: 6,208,257	V947A	probably benign	Het
Kif9	A	G	9: 110,489,867	H133R	probably benign	Het
Lce1l	T	C	3: 92,850,474	T26A	unknown	Het
Macf1	T	C	4: 123,493,988	E1172G	probably damaging	Het
Nkx3-2	C	T	5: 41,763,938	V3M	probably damaging	Het
Nr2e1	G	A	10: 42,578,191	T49I	probably benign	Het
Oc90	A	G	15: 65,892,393	L138P	probably damaging	Het
Olfr834	T	G	9: 18,987,982		probably null	Het
Olfr954	C	T	9: 39,462,231	R264*	probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Paqr3	T	A	5: 97,103,361	N168I	possibly damaging	Het
Pcdhac1	T	A	18: 37,091,379	I415N	probably damaging	Het
Pdik1l	T	C	4: 134,278,896	N75S	probably damaging	Het
Pik3r4	A	G	9: 105,672,725	H1005R	probably damaging	Het
Prkch	A	G	12: 73,702,838	T402A	possibly damaging	Het
Ptger4	C	A	15: 5,242,379	R253L	probably damaging	Het
Rabac1	A	T	7: 24,970,160	Y173*	probably null	Het
Rapsn	G	A	2: 91,043,212	V288M	possibly damaging	Het
Sec31a	A	G	5: 100,365,958	S993P	probably damaging	Het
Serpina9	T	A	12: 104,001,294	M281L	probably benign	Het
Serpine1	G	A	5: 137,069,468	A117V	probably damaging	Het
Sh3tc2	A	G	18: 61,987,693		probably null	Het
Sipa1l2	T	C	8: 125,492,226	D124G	probably benign	Het
Slc6a12	T	A	6: 121,353,530		probably null	Het
Stk11	A	G	10: 80,116,601		probably benign	Het
Tcaf3	A	G	6: 42,589,996	Y720H	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,196	R224K	probably damaging	Het
Tmprss15	C	T	16: 78,957,356	S988N	probably benign	Het
Txn2	A	T	15: 77,915,443		probably null	Het
Ugt1a10	T	A	1: 88,056,197	V239E	probably damaging	Het
Vmn2r102	A	G	17: 19,681,213	Y534C	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het

Other mutations in Plekhn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Plekhn1	APN	4	156223363	missense	probably damaging	1.00
IGL00473:Plekhn1	APN	4	156223363	missense	probably damaging	1.00
IGL02104:Plekhn1	APN	4	156222408	missense	probably benign	0.25
IGL02122:Plekhn1	APN	4	156223856	critical splice donor site	probably null
IGL02210:Plekhn1	APN	4	156223649	missense	probably damaging	1.00
PIT4142001:Plekhn1	UTSW	4	156224940	nonsense	probably null
PIT4366001:Plekhn1	UTSW	4	156224811	missense	probably damaging	0.99
R0123:Plekhn1	UTSW	4	156228243	missense	probably benign	0.13
R0134:Plekhn1	UTSW	4	156228243	missense	probably benign	0.13
R0225:Plekhn1	UTSW	4	156228243	missense	probably benign	0.13
R0276:Plekhn1	UTSW	4	156228246	missense	probably damaging	0.99
R0282:Plekhn1	UTSW	4	156228323	splice site	probably benign
R0540:Plekhn1	UTSW	4	156222747	missense	possibly damaging	0.87
R0569:Plekhn1	UTSW	4	156225201	missense	probably damaging	1.00
R0656:Plekhn1	UTSW	4	156225364	missense	possibly damaging	0.55
R0798:Plekhn1	UTSW	4	156228263	missense	probably damaging	0.96
R0848:Plekhn1	UTSW	4	156223564	critical splice donor site	probably null
R1803:Plekhn1	UTSW	4	156222381	missense	probably benign	0.20
R2168:Plekhn1	UTSW	4	156221882	missense	probably damaging	0.99
R2356:Plekhn1	UTSW	4	156222701	missense	probably damaging	1.00
R2516:Plekhn1	UTSW	4	156222659	missense	probably damaging	1.00
R3746:Plekhn1	UTSW	4	156225594	missense	probably benign	0.00
R3818:Plekhn1	UTSW	4	156225533	missense	probably damaging	1.00
R3902:Plekhn1	UTSW	4	156225669	missense	possibly damaging	0.75
R4024:Plekhn1	UTSW	4	156224750	missense	probably damaging	1.00
R4057:Plekhn1	UTSW	4	156224693	splice site	probably null
R4176:Plekhn1	UTSW	4	156221801	missense	probably benign	0.02
R4402:Plekhn1	UTSW	4	156225356	missense	probably damaging	1.00
R4405:Plekhn1	UTSW	4	156225273	splice site	probably null
R4477:Plekhn1	UTSW	4	156223399	missense	probably damaging	1.00
R4517:Plekhn1	UTSW	4	156225531	missense	probably damaging	1.00
R4518:Plekhn1	UTSW	4	156225531	missense	probably damaging	1.00
R5086:Plekhn1	UTSW	4	156222424	missense	probably benign	0.00
R5092:Plekhn1	UTSW	4	156224765	missense	possibly damaging	0.93
R5201:Plekhn1	UTSW	4	156230527	missense	probably benign	0.00
R5896:Plekhn1	UTSW	4	156223874	missense	probably benign	0.02
R5913:Plekhn1	UTSW	4	156222695	missense	probably damaging	1.00
R6124:Plekhn1	UTSW	4	156225239	missense	possibly damaging	0.87
R6244:Plekhn1	UTSW	4	156230558	splice site	probably null
R6263:Plekhn1	UTSW	4	156225193	critical splice donor site	probably null
R6430:Plekhn1	UTSW	4	156221804	missense	probably benign	0.00
R6703:Plekhn1	UTSW	4	156224793	missense	probably benign	0.00
R6723:Plekhn1	UTSW	4	156224569	missense	probably damaging	1.00
R6741:Plekhn1	UTSW	4	156221792	missense	probably damaging	0.98
R7057:Plekhn1	UTSW	4	156233917	missense	probably damaging	0.99
R7135:Plekhn1	UTSW	4	156223335	missense	probably benign	0.04
R7347:Plekhn1	UTSW	4	156222671	missense	probably benign	0.00
R7408:Plekhn1	UTSW	4	156233961	missense	probably benign	0.14
R7423:Plekhn1	UTSW	4	156230685	missense	probably benign	0.15
R7500:Plekhn1	UTSW	4	156233314	missense	probably benign	0.19
R7613:Plekhn1	UTSW	4	156224820	missense	probably benign	0.00
R7626:Plekhn1	UTSW	4	156225653	missense	probably benign	0.00
R7738:Plekhn1	UTSW	4	156232234	missense	probably damaging	1.00
R8065:Plekhn1	UTSW	4	156228240	missense	possibly damaging	0.75
R8067:Plekhn1	UTSW	4	156228240	missense	possibly damaging	0.75
R8744:Plekhn1	UTSW	4	156233907	missense	probably damaging	1.00
R8746:Plekhn1	UTSW	4	156232225	missense	probably damaging	1.00
R8839:Plekhn1	UTSW	4	156222589	intron	probably benign
R8841:Plekhn1	UTSW	4	156232198	missense	probably damaging	0.98
R8900:Plekhn1	UTSW	4	156225621	missense	possibly damaging	0.87
R9208:Plekhn1	UTSW	4	156222402	missense	possibly damaging	0.86
R9723:Plekhn1	UTSW	4	156222418	missense	probably benign	0.00
X0023:Plekhn1	UTSW	4	156222354	missense	possibly damaging	0.76
X0065:Plekhn1	UTSW	4	156224915	critical splice donor site	probably null
Z1176:Plekhn1	UTSW	4	156223431	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TGCCACTCACCTGGAATGTAAG -3'
(R):5'- CAGAAGCTGTGTGTATATCGCTTG -3'

Sequencing Primer
(F):5'- TGTAAGTCCCTCAGAACCATGGG -3'
(R):5'- ATATCGCTTGGGGATCCGGC -3'

Posted On

2015-08-18