Incidental Mutation 'R4515:Plekhn1'
ID 332840
Institutional Source Beutler Lab
Gene Symbol Plekhn1
Ensembl Gene ENSMUSG00000078485
Gene Name pleckstrin homology domain containing, family N member 1
Synonyms
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 156305913-156312999 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 156309988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 109 (S109G)
Ref Sequence ENSEMBL: ENSMUSP00000151799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105569] [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
AlphaFold Q8C886
Predicted Effect probably benign
Transcript: ENSMUST00000105569
SMART Domains Protein: ENSMUSP00000101194
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
low complexity region 20 50 N/A INTRINSIC
BTB 90 187 3.55e-30 SMART
BACK 192 294 1.08e-42 SMART
Kelch 341 387 4.01e-8 SMART
Kelch 388 434 5.41e-14 SMART
Kelch 435 481 6.97e-17 SMART
Kelch 482 528 1.55e-14 SMART
Kelch 529 575 2.02e-13 SMART
Kelch 576 622 1.34e-9 SMART
low complexity region 626 640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105571
AA Change: S109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485
AA Change: S109G

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184043
Predicted Effect probably damaging
Transcript: ENSMUST00000217885
AA Change: S109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218699
AA Change: S109G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Meta Mutation Damage Score 0.2474 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chd3 G T 11: 69,240,703 (GRCm39) R1579S probably benign Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Ckm A G 7: 19,154,209 (GRCm39) K319E probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Foxi1 A G 11: 34,157,972 (GRCm39) F18L probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Rnf26rt C T 6: 76,473,792 (GRCm39) V275I probably benign Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Slc6a12 T A 6: 121,330,489 (GRCm39) probably null Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss11a C T 5: 86,568,055 (GRCm39) R224K probably damaging Het
Tmprss15 C T 16: 78,754,244 (GRCm39) S988N probably benign Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Ugt1a10 T A 1: 87,983,919 (GRCm39) V239E probably damaging Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Plekhn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Plekhn1 APN 4 156,307,820 (GRCm39) missense probably damaging 1.00
IGL00473:Plekhn1 APN 4 156,307,820 (GRCm39) missense probably damaging 1.00
IGL02104:Plekhn1 APN 4 156,306,865 (GRCm39) missense probably benign 0.25
IGL02122:Plekhn1 APN 4 156,308,313 (GRCm39) critical splice donor site probably null
IGL02210:Plekhn1 APN 4 156,308,106 (GRCm39) missense probably damaging 1.00
PIT4142001:Plekhn1 UTSW 4 156,309,397 (GRCm39) nonsense probably null
PIT4366001:Plekhn1 UTSW 4 156,309,268 (GRCm39) missense probably damaging 0.99
R0123:Plekhn1 UTSW 4 156,312,700 (GRCm39) missense probably benign 0.13
R0134:Plekhn1 UTSW 4 156,312,700 (GRCm39) missense probably benign 0.13
R0225:Plekhn1 UTSW 4 156,312,700 (GRCm39) missense probably benign 0.13
R0276:Plekhn1 UTSW 4 156,312,703 (GRCm39) missense probably damaging 0.99
R0282:Plekhn1 UTSW 4 156,312,780 (GRCm39) splice site probably benign
R0540:Plekhn1 UTSW 4 156,307,204 (GRCm39) missense possibly damaging 0.87
R0569:Plekhn1 UTSW 4 156,309,658 (GRCm39) missense probably damaging 1.00
R0656:Plekhn1 UTSW 4 156,309,821 (GRCm39) missense possibly damaging 0.55
R0798:Plekhn1 UTSW 4 156,312,720 (GRCm39) missense probably damaging 0.96
R0848:Plekhn1 UTSW 4 156,308,021 (GRCm39) critical splice donor site probably null
R1803:Plekhn1 UTSW 4 156,306,838 (GRCm39) missense probably benign 0.20
R2168:Plekhn1 UTSW 4 156,306,339 (GRCm39) missense probably damaging 0.99
R2356:Plekhn1 UTSW 4 156,307,158 (GRCm39) missense probably damaging 1.00
R2516:Plekhn1 UTSW 4 156,307,116 (GRCm39) missense probably damaging 1.00
R3746:Plekhn1 UTSW 4 156,310,051 (GRCm39) missense probably benign 0.00
R3818:Plekhn1 UTSW 4 156,309,990 (GRCm39) missense probably damaging 1.00
R3902:Plekhn1 UTSW 4 156,310,126 (GRCm39) missense possibly damaging 0.75
R4024:Plekhn1 UTSW 4 156,309,207 (GRCm39) missense probably damaging 1.00
R4057:Plekhn1 UTSW 4 156,309,150 (GRCm39) splice site probably null
R4176:Plekhn1 UTSW 4 156,306,258 (GRCm39) missense probably benign 0.02
R4402:Plekhn1 UTSW 4 156,309,813 (GRCm39) missense probably damaging 1.00
R4405:Plekhn1 UTSW 4 156,309,730 (GRCm39) splice site probably null
R4477:Plekhn1 UTSW 4 156,307,856 (GRCm39) missense probably damaging 1.00
R4517:Plekhn1 UTSW 4 156,309,988 (GRCm39) missense probably damaging 1.00
R4518:Plekhn1 UTSW 4 156,309,988 (GRCm39) missense probably damaging 1.00
R5086:Plekhn1 UTSW 4 156,306,881 (GRCm39) missense probably benign 0.00
R5092:Plekhn1 UTSW 4 156,309,222 (GRCm39) missense possibly damaging 0.93
R5201:Plekhn1 UTSW 4 156,314,984 (GRCm39) missense probably benign 0.00
R5896:Plekhn1 UTSW 4 156,308,331 (GRCm39) missense probably benign 0.02
R5913:Plekhn1 UTSW 4 156,307,152 (GRCm39) missense probably damaging 1.00
R6124:Plekhn1 UTSW 4 156,309,696 (GRCm39) missense possibly damaging 0.87
R6244:Plekhn1 UTSW 4 156,315,015 (GRCm39) splice site probably null
R6263:Plekhn1 UTSW 4 156,309,650 (GRCm39) critical splice donor site probably null
R6430:Plekhn1 UTSW 4 156,306,261 (GRCm39) missense probably benign 0.00
R6703:Plekhn1 UTSW 4 156,309,250 (GRCm39) missense probably benign 0.00
R6723:Plekhn1 UTSW 4 156,309,026 (GRCm39) missense probably damaging 1.00
R6741:Plekhn1 UTSW 4 156,306,249 (GRCm39) missense probably damaging 0.98
R7057:Plekhn1 UTSW 4 156,318,374 (GRCm39) missense probably damaging 0.99
R7135:Plekhn1 UTSW 4 156,307,792 (GRCm39) missense probably benign 0.04
R7347:Plekhn1 UTSW 4 156,307,128 (GRCm39) missense probably benign 0.00
R7408:Plekhn1 UTSW 4 156,318,418 (GRCm39) missense probably benign 0.14
R7423:Plekhn1 UTSW 4 156,315,142 (GRCm39) missense probably benign 0.15
R7500:Plekhn1 UTSW 4 156,317,771 (GRCm39) missense probably benign 0.19
R7613:Plekhn1 UTSW 4 156,309,277 (GRCm39) missense probably benign 0.00
R7626:Plekhn1 UTSW 4 156,310,110 (GRCm39) missense probably benign 0.00
R7738:Plekhn1 UTSW 4 156,316,691 (GRCm39) missense probably damaging 1.00
R8065:Plekhn1 UTSW 4 156,312,697 (GRCm39) missense possibly damaging 0.75
R8067:Plekhn1 UTSW 4 156,312,697 (GRCm39) missense possibly damaging 0.75
R8744:Plekhn1 UTSW 4 156,318,364 (GRCm39) missense probably damaging 1.00
R8746:Plekhn1 UTSW 4 156,316,682 (GRCm39) missense probably damaging 1.00
R8839:Plekhn1 UTSW 4 156,307,046 (GRCm39) intron probably benign
R8841:Plekhn1 UTSW 4 156,316,655 (GRCm39) missense probably damaging 0.98
R8900:Plekhn1 UTSW 4 156,310,078 (GRCm39) missense possibly damaging 0.87
R9208:Plekhn1 UTSW 4 156,306,859 (GRCm39) missense possibly damaging 0.86
R9723:Plekhn1 UTSW 4 156,306,875 (GRCm39) missense probably benign 0.00
X0023:Plekhn1 UTSW 4 156,306,811 (GRCm39) missense possibly damaging 0.76
X0065:Plekhn1 UTSW 4 156,309,372 (GRCm39) critical splice donor site probably null
Z1176:Plekhn1 UTSW 4 156,307,888 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGCCACTCACCTGGAATGTAAG -3'
(R):5'- CAGAAGCTGTGTGTATATCGCTTG -3'

Sequencing Primer
(F):5'- TGTAAGTCCCTCAGAACCATGGG -3'
(R):5'- ATATCGCTTGGGGATCCGGC -3'
Posted On 2015-08-18