Incidental Mutation 'R4515:Tmprss11a'
ID 332842
Institutional Source Beutler Lab
Gene Symbol Tmprss11a
Ensembl Gene ENSMUSG00000072845
Gene Name transmembrane protease, serine 11a
Synonyms LOC194597
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 86558269-86616849 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86568055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 224 (R224K)
Ref Sequence ENSEMBL: ENSMUSP00000098634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101073]
AlphaFold Q3UQ41
Predicted Effect probably damaging
Transcript: ENSMUST00000101073
AA Change: R224K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098634
Gene: ENSMUSG00000072845
AA Change: R224K

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
Pfam:SEA 36 135 3.2e-23 PFAM
Tryp_SPc 157 383 1.98e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198504
Meta Mutation Damage Score 0.1400 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chd3 G T 11: 69,240,703 (GRCm39) R1579S probably benign Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Ckm A G 7: 19,154,209 (GRCm39) K319E probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Foxi1 A G 11: 34,157,972 (GRCm39) F18L probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Rnf26rt C T 6: 76,473,792 (GRCm39) V275I probably benign Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Slc6a12 T A 6: 121,330,489 (GRCm39) probably null Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss15 C T 16: 78,754,244 (GRCm39) S988N probably benign Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Ugt1a10 T A 1: 87,983,919 (GRCm39) V239E probably damaging Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Tmprss11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Tmprss11a APN 5 86,570,378 (GRCm39) missense probably damaging 1.00
IGL02413:Tmprss11a APN 5 86,570,507 (GRCm39) missense possibly damaging 0.50
IGL02533:Tmprss11a APN 5 86,562,386 (GRCm39) missense probably damaging 0.96
R1202:Tmprss11a UTSW 5 86,559,784 (GRCm39) critical splice acceptor site probably null
R1273:Tmprss11a UTSW 5 86,562,447 (GRCm39) missense probably benign 0.10
R1704:Tmprss11a UTSW 5 86,576,561 (GRCm39) missense probably benign 0.25
R1756:Tmprss11a UTSW 5 86,568,038 (GRCm39) missense probably damaging 1.00
R1783:Tmprss11a UTSW 5 86,567,891 (GRCm39) missense probably damaging 0.98
R1967:Tmprss11a UTSW 5 86,579,702 (GRCm39) missense probably benign 0.23
R2944:Tmprss11a UTSW 5 86,576,511 (GRCm39) missense probably benign 0.19
R3881:Tmprss11a UTSW 5 86,593,664 (GRCm39) missense possibly damaging 0.85
R4512:Tmprss11a UTSW 5 86,576,437 (GRCm39) missense probably benign 0.00
R4530:Tmprss11a UTSW 5 86,576,540 (GRCm39) missense possibly damaging 0.79
R4543:Tmprss11a UTSW 5 86,559,668 (GRCm39) nonsense probably null
R4881:Tmprss11a UTSW 5 86,570,432 (GRCm39) missense probably damaging 1.00
R5066:Tmprss11a UTSW 5 86,567,859 (GRCm39) critical splice donor site probably null
R5186:Tmprss11a UTSW 5 86,567,938 (GRCm39) missense probably damaging 1.00
R5254:Tmprss11a UTSW 5 86,559,665 (GRCm39) missense probably damaging 0.99
R5313:Tmprss11a UTSW 5 86,559,674 (GRCm39) missense probably damaging 1.00
R6516:Tmprss11a UTSW 5 86,567,987 (GRCm39) missense probably damaging 1.00
R6920:Tmprss11a UTSW 5 86,576,494 (GRCm39) missense probably benign 0.23
R7018:Tmprss11a UTSW 5 86,576,429 (GRCm39) missense probably damaging 0.96
R7566:Tmprss11a UTSW 5 86,591,993 (GRCm39) missense possibly damaging 0.50
R7962:Tmprss11a UTSW 5 86,567,879 (GRCm39) missense probably damaging 1.00
R9299:Tmprss11a UTSW 5 86,570,361 (GRCm39) nonsense probably null
R9479:Tmprss11a UTSW 5 86,562,402 (GRCm39) nonsense probably null
R9529:Tmprss11a UTSW 5 86,576,501 (GRCm39) missense probably benign 0.00
R9591:Tmprss11a UTSW 5 86,567,897 (GRCm39) missense possibly damaging 0.79
X0057:Tmprss11a UTSW 5 86,593,667 (GRCm39) missense probably benign 0.03
X0063:Tmprss11a UTSW 5 86,562,437 (GRCm39) missense probably damaging 1.00
Z1176:Tmprss11a UTSW 5 86,576,490 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTTGCTGCTCTGAGGTAC -3'
(R):5'- ATTGCAACCAGCTATTGTCAGG -3'

Sequencing Primer
(F):5'- AAAGTGCTCCGAATCCTGTG -3'
(R):5'- AACCAGCTATTGTCAGGGTGGTATG -3'
Posted On 2015-08-18