Incidental Mutation 'R4515:Paqr3'
ID332843
Institutional Source Beutler Lab
Gene Symbol Paqr3
Ensembl Gene ENSMUSG00000055725
Gene Nameprogestin and adipoQ receptor family member III
Synonyms6330415A20Rik, RKTG
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location97082329-97111596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97103361 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 168 (N168I)
Ref Sequence ENSEMBL: ENSMUSP00000108592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069453] [ENSMUST00000112968] [ENSMUST00000112969] [ENSMUST00000196078]
Predicted Effect probably benign
Transcript: ENSMUST00000069453
AA Change: N168I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725
AA Change: N168I

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112968
AA Change: N168I

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108592
Gene: ENSMUSG00000055725
AA Change: N168I

DomainStartEndE-ValueType
Pfam:HlyIII 64 171 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112969
AA Change: N168I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725
AA Change: N168I

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132127
Predicted Effect probably benign
Transcript: ENSMUST00000196078
AA Change: N168I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142871
Gene: ENSMUSG00000055725
AA Change: N168I

DomainStartEndE-ValueType
Pfam:HlyIII 64 179 7e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Meta Mutation Damage Score 0.1411 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype PHENOTYPE: Targeted deletion of this gene causes faster chemical carcinogen-induced skin cell proliferation, higher epidermal thickness, increased number and size of skin papillomas, shorter tumor latency and delayed tumor regression. Heterozygotes develop tumors earlier and more frequently than control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Paqr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Paqr3 APN 5 97095937 missense probably benign
IGL01966:Paqr3 APN 5 97099643 missense probably benign 0.21
IGL02133:Paqr3 APN 5 97095931 missense probably benign
PIT4618001:Paqr3 UTSW 5 97103471 missense possibly damaging 0.82
R1601:Paqr3 UTSW 5 97111389 missense probably benign 0.01
R2864:Paqr3 UTSW 5 97099736 missense possibly damaging 0.65
R3419:Paqr3 UTSW 5 97099700 missense probably damaging 1.00
R3799:Paqr3 UTSW 5 97111316 missense probably damaging 1.00
R4352:Paqr3 UTSW 5 97099596 missense probably benign 0.05
R4368:Paqr3 UTSW 5 97108291 missense probably damaging 1.00
R4583:Paqr3 UTSW 5 97108210 nonsense probably null
R4647:Paqr3 UTSW 5 97108210 nonsense probably null
R4648:Paqr3 UTSW 5 97108210 nonsense probably null
R4811:Paqr3 UTSW 5 97095983 missense probably benign 0.00
R4855:Paqr3 UTSW 5 97108194 missense possibly damaging 0.83
R5910:Paqr3 UTSW 5 97096028 unclassified probably null
R6053:Paqr3 UTSW 5 97111278 missense probably benign 0.12
R6156:Paqr3 UTSW 5 97108269 missense probably damaging 1.00
R6957:Paqr3 UTSW 5 97108251 missense possibly damaging 0.48
R6974:Paqr3 UTSW 5 97108287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCATACGTATAGTCATAGTTTC -3'
(R):5'- ATGGATTGCTCAGCTCTCCG -3'

Sequencing Primer
(F):5'- GCGAGCACAGAAATCTTC -3'
(R):5'- GGATTGCTCAGCTCTCCGTTTTC -3'
Posted On2015-08-18