Mutagenetix > Incidental Mutations

Incidental Mutation 'R4515:Sec31a'

332844

Institutional Source

Beutler Lab

Gene Symbol

Sec31a

Ensembl Gene

ENSMUSG00000035325

Gene Name

Sec31 homolog A (S. cerevisiae)

Synonyms

Sec31l1, 1810024J13Rik

MMRRC Submission

041589-MU

Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene?

Probably essential (E-score: 0.796) question?

Stock #

R4515 (G1)

Quality Score

216

Status

Validated

Chromosome

Chromosomal Location

100361649-100416234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100365958 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 993 (S993P)

Ref Sequence

ENSEMBL: ENSMUSP00000138213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094578
AA Change: S1032P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: S1032P

Domain	Start	End	E-Value	Type
WD40	56	102	1.59e1	SMART
WD40	111	151	5.15e-2	SMART
WD40	158	197	5.16e-1	SMART
WD40	200	245	6.63e0	SMART
WD40	249	289	1.95e-2	SMART
WD40	292	332	4.24e-3	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	572	769	3.5e-7	PFAM
low complexity region	866	882	N/A	INTRINSIC
low complexity region	930	949	N/A	INTRINSIC
low complexity region	953	975	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000182002
AA Change: S228P

Predicted Effect

unknown
Transcript: ENSMUST00000182433
AA Change: S65P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182664

Predicted Effect

unknown
Transcript: ENSMUST00000182812
AA Change: S218P

Predicted Effect

probably damaging
Transcript: ENSMUST00000182886
AA Change: S993P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: S993P

Domain	Start	End	E-Value	Type
WD40	56	102	1e-1	SMART
WD40	111	151	3.3e-4	SMART
WD40	158	197	3.2e-3	SMART
WD40	200	245	4.1e-2	SMART
WD40	249	289	1.2e-4	SMART
WD40	292	332	2.6e-5	SMART
low complexity region	363	373	N/A	INTRINSIC
Pfam:Sec16_C	532	731	2.1e-6	PFAM
low complexity region	827	843	N/A	INTRINSIC
low complexity region	891	910	N/A	INTRINSIC
low complexity region	914	936	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000182988
AA Change: S735P

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (65/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	G	T	5: 138,647,744	K630N	probably damaging	Het
Acss2	C	A	2: 155,556,363	L335I	probably benign	Het
Alg6	A	T	4: 99,752,786		probably benign	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Bsn	G	T	9: 108,104,078		probably null	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cdhr4	G	A	9: 107,992,951	E52K	probably benign	Het
Ces1a	T	A	8: 93,020,904	N500Y	probably damaging	Het
Chd3	G	T	11: 69,349,877	R1579S	probably benign	Het
Chrnb3	T	C	8: 27,385,090	L39P	probably damaging	Het
Ckm	A	G	7: 19,420,284	K319E	probably damaging	Het
Cnot6	C	T	11: 49,702,536		probably null	Het
Copg1	A	G	6: 87,907,546		probably benign	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnah2	A	G	11: 69,465,631	S2135P	possibly damaging	Het
Dsg2	C	A	18: 20,601,387	D807E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxi1	A	G	11: 34,207,972	F18L	probably damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Glod4	T	A	11: 76,243,571	D25V	probably damaging	Het
Gm11492	A	G	11: 87,568,057	H419R	probably benign	Het
Gm9008	C	T	6: 76,496,809	V275I	probably benign	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
H2-M10.3	C	T	17: 36,367,830		probably null	Het
Hemgn	T	C	4: 46,396,477	E253G	probably damaging	Het
Itsn1	G	A	16: 91,899,649	V47M	probably damaging	Het
Kif5b	A	G	18: 6,208,257	V947A	probably benign	Het
Kif9	A	G	9: 110,489,867	H133R	probably benign	Het
Lce1l	T	C	3: 92,850,474	T26A	unknown	Het
Macf1	T	C	4: 123,493,988	E1172G	probably damaging	Het
Nkx3-2	C	T	5: 41,763,938	V3M	probably damaging	Het
Nr2e1	G	A	10: 42,578,191	T49I	probably benign	Het
Oc90	A	G	15: 65,892,393	L138P	probably damaging	Het
Olfr834	T	G	9: 18,987,982		probably null	Het
Olfr954	C	T	9: 39,462,231	R264*	probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Paqr3	T	A	5: 97,103,361	N168I	possibly damaging	Het
Pcdhac1	T	A	18: 37,091,379	I415N	probably damaging	Het
Pdik1l	T	C	4: 134,278,896	N75S	probably damaging	Het
Pik3r4	A	G	9: 105,672,725	H1005R	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Prkch	A	G	12: 73,702,838	T402A	possibly damaging	Het
Ptger4	C	A	15: 5,242,379	R253L	probably damaging	Het
Rabac1	A	T	7: 24,970,160	Y173*	probably null	Het
Rapsn	G	A	2: 91,043,212	V288M	possibly damaging	Het
Serpina9	T	A	12: 104,001,294	M281L	probably benign	Het
Serpine1	G	A	5: 137,069,468	A117V	probably damaging	Het
Sh3tc2	A	G	18: 61,987,693		probably null	Het
Sipa1l2	T	C	8: 125,492,226	D124G	probably benign	Het
Slc6a12	T	A	6: 121,353,530		probably null	Het
Stk11	A	G	10: 80,116,601		probably benign	Het
Tcaf3	A	G	6: 42,589,996	Y720H	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,196	R224K	probably damaging	Het
Tmprss15	C	T	16: 78,957,356	S988N	probably benign	Het
Txn2	A	T	15: 77,915,443		probably null	Het
Ugt1a10	T	A	1: 88,056,197	V239E	probably damaging	Het
Vmn2r102	A	G	17: 19,681,213	Y534C	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het

Other mutations in Sec31a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Sec31a	APN	5	100404017	nonsense	probably null
IGL01610:Sec31a	APN	5	100402358	splice site	probably benign
IGL01804:Sec31a	APN	5	100375206	critical splice donor site	probably null
IGL02026:Sec31a	APN	5	100369626	missense	probably benign	0.04
IGL02150:Sec31a	APN	5	100386125	splice site	probably benign
IGL02237:Sec31a	APN	5	100362055	missense	probably damaging	1.00
IGL02469:Sec31a	APN	5	100385255	missense	probably benign	0.02
IGL02512:Sec31a	APN	5	100407193	missense	probably damaging	0.99
control	UTSW	5	100362173	missense	probably damaging	1.00
Discipline	UTSW	5	100363878	missense	probably damaging	1.00
D3080:Sec31a	UTSW	5	100363832	missense	probably damaging	1.00
PIT4142001:Sec31a	UTSW	5	100407275	missense	probably damaging	1.00
R0366:Sec31a	UTSW	5	100382766	missense	probably damaging	1.00
R0453:Sec31a	UTSW	5	100404118	splice site	probably benign
R0511:Sec31a	UTSW	5	100375240	missense	probably benign	0.01
R0546:Sec31a	UTSW	5	100404070	missense	probably damaging	1.00
R0675:Sec31a	UTSW	5	100393207	missense	probably damaging	0.97
R0678:Sec31a	UTSW	5	100407225	missense	possibly damaging	0.74
R0975:Sec31a	UTSW	5	100395904	unclassified	probably null
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1146:Sec31a	UTSW	5	100362173	missense	probably damaging	1.00
R1540:Sec31a	UTSW	5	100375319	missense	probably damaging	1.00
R1616:Sec31a	UTSW	5	100386195	missense	possibly damaging	0.88
R1780:Sec31a	UTSW	5	100381336	splice site	probably null
R2472:Sec31a	UTSW	5	100385205	missense	probably damaging	1.00
R3689:Sec31a	UTSW	5	100382907	missense	probably damaging	1.00
R4801:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4802:Sec31a	UTSW	5	100393363	missense	probably damaging	0.96
R4896:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5004:Sec31a	UTSW	5	100368333	missense	probably damaging	1.00
R5053:Sec31a	UTSW	5	100393214	missense	possibly damaging	0.94
R5158:Sec31a	UTSW	5	100393321	missense	probably damaging	0.99
R5191:Sec31a	UTSW	5	100405511	missense	possibly damaging	0.75
R5222:Sec31a	UTSW	5	100382895	missense	probably benign
R5405:Sec31a	UTSW	5	100383798	nonsense	probably null
R5436:Sec31a	UTSW	5	100363839	missense	probably damaging	0.98
R5577:Sec31a	UTSW	5	100402274	missense	possibly damaging	0.95
R6005:Sec31a	UTSW	5	100363878	missense	probably damaging	1.00
R6184:Sec31a	UTSW	5	100369594	critical splice donor site	probably null
R6245:Sec31a	UTSW	5	100386184	missense	probably benign	0.07
R6475:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R6476:Sec31a	UTSW	5	100386149	missense	probably benign	0.03
R6744:Sec31a	UTSW	5	100392499	missense	possibly damaging	0.47
R6804:Sec31a	UTSW	5	100382812	missense	probably benign	0.03
R6911:Sec31a	UTSW	5	100393264	missense	possibly damaging	0.92
R6936:Sec31a	UTSW	5	100392510	missense	probably benign
R7345:Sec31a	UTSW	5	100385270	missense	probably damaging	1.00
R7760:Sec31a	UTSW	5	100392628	missense	probably damaging	1.00
R7898:Sec31a	UTSW	5	100399477	missense	probably damaging	0.99
R8088:Sec31a	UTSW	5	100378862	missense
X0003:Sec31a	UTSW	5	100399354	missense	probably damaging	0.98
Z1177:Sec31a	UTSW	5	100383845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCCAATGGGAGCTCCTGG -3'
(R):5'- ACTGCGATGCTTTACTCTGG -3'

Sequencing Primer
(F):5'- CTGGAGCCCCTTCAGTGTTG -3'
(R):5'- CTCTGGAATTGTGCATAGCATTTC -3'

Posted On

2015-08-18