Incidental Mutation 'R4515:Serpine1'
ID 332845
Institutional Source Beutler Lab
Gene Symbol Serpine1
Ensembl Gene ENSMUSG00000037411
Gene Name serine (or cysteine) peptidase inhibitor, clade E, member 1
Synonyms PAI-1, PAI1, Planh1
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 137061504-137072268 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 137069468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 117 (A117V)
Ref Sequence ENSEMBL: ENSMUSP00000076728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041388] [ENSMUST00000077523]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041388
AA Change: A117V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039586
Gene: ENSMUSG00000037411
AA Change: A117V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 40 402 9.47e-158 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077523
AA Change: A117V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076728
Gene: ENSMUSG00000037411
AA Change: A117V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 40 402 9.47e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199832
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. Defects in this gene are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency), and high concentrations of the gene product are associated with thrombophilia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Although mice homozygous for disruptions in this gene display an essentially normal phenotype, a mild blood clotting defect does exist. Mice homozygous for an allele with amino acid substitutions exhibit decreased sensitivity to LPS-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Serpine1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Serpine1 APN 5 137063522 missense probably benign 0.01
IGL01337:Serpine1 APN 5 137069331 missense probably damaging 0.99
IGL01484:Serpine1 APN 5 137063472 splice site probably benign
IGL02134:Serpine1 APN 5 137067035 splice site probably benign
R0508:Serpine1 UTSW 5 137064916 missense probably benign 0.00
R1969:Serpine1 UTSW 5 137067747 nonsense probably null
R4951:Serpine1 UTSW 5 137069351 missense probably benign 0.04
R5540:Serpine1 UTSW 5 137063209 missense probably benign 0.03
R7122:Serpine1 UTSW 5 137066942 missense probably benign 0.28
R7144:Serpine1 UTSW 5 137071064 missense probably damaging 1.00
R7146:Serpine1 UTSW 5 137071064 missense probably damaging 1.00
R7844:Serpine1 UTSW 5 137071189 nonsense probably null
R8042:Serpine1 UTSW 5 137067001 missense probably benign
R8550:Serpine1 UTSW 5 137063498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTTGACACCGAATTCCCCTTC -3'
(R):5'- TTGGAAGAGCCTCATCTGCC -3'

Sequencing Primer
(F):5'- GGGACTGGCTTGCTTTCCC -3'
(R):5'- AAGAGCCTCATCTGCCTGGAC -3'
Posted On 2015-08-18