Incidental Mutation 'R4515:Rnf26rt'
ID 332848
Institutional Source Beutler Lab
Gene Symbol Rnf26rt
Ensembl Gene ENSMUSG00000072476
Gene Name ring finger protein 26, retrotransposed
Synonyms Gm9008
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 76472428-76474716 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 76473792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 275 (V275I)
Ref Sequence ENSEMBL: ENSMUSP00000126976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097218]
AlphaFold E9PVG0
Predicted Effect probably benign
Transcript: ENSMUST00000097218
AA Change: V275I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126976
Gene: ENSMUSG00000072476
AA Change: V275I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
RING 371 412 8.29e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204070
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chd3 G T 11: 69,240,703 (GRCm39) R1579S probably benign Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Ckm A G 7: 19,154,209 (GRCm39) K319E probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Foxi1 A G 11: 34,157,972 (GRCm39) F18L probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Slc6a12 T A 6: 121,330,489 (GRCm39) probably null Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss11a C T 5: 86,568,055 (GRCm39) R224K probably damaging Het
Tmprss15 C T 16: 78,754,244 (GRCm39) S988N probably benign Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Ugt1a10 T A 1: 87,983,919 (GRCm39) V239E probably damaging Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Rnf26rt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0322:Rnf26rt UTSW 6 76,473,401 (GRCm39) missense probably benign 0.14
R0943:Rnf26rt UTSW 6 76,473,398 (GRCm39) missense probably benign 0.09
R1767:Rnf26rt UTSW 6 76,474,588 (GRCm39) missense unknown
R1807:Rnf26rt UTSW 6 76,474,397 (GRCm39) missense probably benign 0.09
R3773:Rnf26rt UTSW 6 76,473,942 (GRCm39) missense probably benign 0.00
R6408:Rnf26rt UTSW 6 76,473,441 (GRCm39) missense probably damaging 1.00
R7686:Rnf26rt UTSW 6 76,474,013 (GRCm39) missense probably damaging 1.00
R8162:Rnf26rt UTSW 6 76,473,558 (GRCm39) missense probably benign 0.04
R9192:Rnf26rt UTSW 6 76,473,566 (GRCm39) missense probably benign 0.00
R9467:Rnf26rt UTSW 6 76,473,615 (GRCm39) missense probably benign 0.04
R9607:Rnf26rt UTSW 6 76,473,923 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCTGCTTCAGGAGGAGTGTC -3'
(R):5'- ATGGCCATTCTCCTGTGGAC -3'

Sequencing Primer
(F):5'- AGTGTCCTGTGGCTGGATCC -3'
(R):5'- CTAGCACTGGAGCTGTTGGC -3'
Posted On 2015-08-18