Incidental Mutation 'R4515:Slc6a12'
ID 332850
Institutional Source Beutler Lab
Gene Symbol Slc6a12
Ensembl Gene ENSMUSG00000030109
Gene Name solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms Gabt2, BGT1
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4515 (G1)
Quality Score 176
Status Validated
Chromosome 6
Chromosomal Location 121320035-121342734 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 121330489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032200] [ENSMUST00000163771] [ENSMUST00000165456] [ENSMUST00000166390] [ENSMUST00000166457] [ENSMUST00000171008] [ENSMUST00000171008]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000032200
SMART Domains Protein: ENSMUSP00000032200
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 50 575 2e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163771
SMART Domains Protein: ENSMUSP00000127779
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 128 3.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165456
SMART Domains Protein: ENSMUSP00000130715
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 49 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166390
SMART Domains Protein: ENSMUSP00000128217
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
low complexity region 35 52 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166457
SMART Domains Protein: ENSMUSP00000126937
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 36 561 2.5e-242 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170582
Predicted Effect probably null
Transcript: ENSMUST00000171008
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171008
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171874
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal seizure threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chd3 G T 11: 69,240,703 (GRCm39) R1579S probably benign Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Ckm A G 7: 19,154,209 (GRCm39) K319E probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Foxi1 A G 11: 34,157,972 (GRCm39) F18L probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Rnf26rt C T 6: 76,473,792 (GRCm39) V275I probably benign Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss11a C T 5: 86,568,055 (GRCm39) R224K probably damaging Het
Tmprss15 C T 16: 78,754,244 (GRCm39) S988N probably benign Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Ugt1a10 T A 1: 87,983,919 (GRCm39) V239E probably damaging Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Slc6a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Slc6a12 APN 6 121,337,414 (GRCm39) missense probably damaging 1.00
IGL02066:Slc6a12 APN 6 121,329,015 (GRCm39) missense probably damaging 0.97
IGL02146:Slc6a12 APN 6 121,330,460 (GRCm39) missense probably benign 0.01
IGL02475:Slc6a12 APN 6 121,331,334 (GRCm39) splice site probably null
IGL02498:Slc6a12 APN 6 121,338,029 (GRCm39) missense probably benign
IGL02537:Slc6a12 APN 6 121,337,473 (GRCm39) missense probably benign 0.00
IGL02696:Slc6a12 APN 6 121,340,211 (GRCm39) missense probably benign 0.00
IGL03255:Slc6a12 APN 6 121,331,246 (GRCm39) missense probably damaging 0.99
IGL03397:Slc6a12 APN 6 121,334,004 (GRCm39) missense probably damaging 1.00
R0050:Slc6a12 UTSW 6 121,337,378 (GRCm39) splice site probably benign
R0050:Slc6a12 UTSW 6 121,337,378 (GRCm39) splice site probably benign
R0201:Slc6a12 UTSW 6 121,332,331 (GRCm39) missense probably benign 0.03
R0255:Slc6a12 UTSW 6 121,333,877 (GRCm39) missense probably damaging 1.00
R0302:Slc6a12 UTSW 6 121,340,218 (GRCm39) missense probably damaging 1.00
R0317:Slc6a12 UTSW 6 121,335,584 (GRCm39) missense possibly damaging 0.80
R0394:Slc6a12 UTSW 6 121,323,957 (GRCm39) critical splice donor site probably null
R0492:Slc6a12 UTSW 6 121,332,331 (GRCm39) missense probably benign 0.03
R0532:Slc6a12 UTSW 6 121,333,877 (GRCm39) missense probably damaging 1.00
R0550:Slc6a12 UTSW 6 121,333,877 (GRCm39) missense probably damaging 1.00
R0551:Slc6a12 UTSW 6 121,333,877 (GRCm39) missense probably damaging 1.00
R1421:Slc6a12 UTSW 6 121,336,085 (GRCm39) missense probably damaging 1.00
R1487:Slc6a12 UTSW 6 121,340,716 (GRCm39) nonsense probably null
R1879:Slc6a12 UTSW 6 121,324,382 (GRCm39) missense probably damaging 1.00
R1905:Slc6a12 UTSW 6 121,324,402 (GRCm39) nonsense probably null
R1925:Slc6a12 UTSW 6 121,337,485 (GRCm39) missense probably benign 0.44
R3944:Slc6a12 UTSW 6 121,331,239 (GRCm39) critical splice acceptor site probably null
R4559:Slc6a12 UTSW 6 121,340,820 (GRCm39) splice site probably null
R4628:Slc6a12 UTSW 6 121,328,951 (GRCm39) nonsense probably null
R4665:Slc6a12 UTSW 6 121,335,972 (GRCm39) splice site probably benign
R4753:Slc6a12 UTSW 6 121,333,862 (GRCm39) splice site probably benign
R4948:Slc6a12 UTSW 6 121,332,281 (GRCm39) missense probably benign 0.35
R5517:Slc6a12 UTSW 6 121,331,298 (GRCm39) missense probably benign 0.10
R6717:Slc6a12 UTSW 6 121,331,262 (GRCm39) missense probably benign 0.01
R7139:Slc6a12 UTSW 6 121,342,278 (GRCm39) missense probably benign
R7318:Slc6a12 UTSW 6 121,328,978 (GRCm39) missense probably benign 0.26
R7318:Slc6a12 UTSW 6 121,328,972 (GRCm39) missense probably damaging 0.99
R8310:Slc6a12 UTSW 6 121,340,250 (GRCm39) missense probably damaging 1.00
R8703:Slc6a12 UTSW 6 121,324,447 (GRCm39) missense probably benign
R9218:Slc6a12 UTSW 6 121,335,623 (GRCm39) missense probably damaging 1.00
R9648:Slc6a12 UTSW 6 121,335,661 (GRCm39) nonsense probably null
R9682:Slc6a12 UTSW 6 121,340,704 (GRCm39) missense probably benign
Z1176:Slc6a12 UTSW 6 121,340,786 (GRCm39) missense probably benign
Z1177:Slc6a12 UTSW 6 121,342,231 (GRCm39) missense probably benign 0.02
Z1177:Slc6a12 UTSW 6 121,333,926 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGGCAGACCCTCCATGAAATTC -3'
(R):5'- GTTGCATAACAGCCCCGTTG -3'

Sequencing Primer
(F):5'- GCTTATGCAGATCTCTTTGACC -3'
(R):5'- GTTGCTTCTAACAGTGCCACACAG -3'
Posted On 2015-08-18