Incidental Mutation 'R4515:Ckm'
ID 332851
Institutional Source Beutler Lab
Gene Symbol Ckm
Ensembl Gene ENSMUSG00000030399
Gene Name creatine kinase, muscle
Synonyms Ckmm, M-CK, MCK
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19145019-19155508 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19154209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 319 (K319E)
Ref Sequence ENSEMBL: ENSMUSP00000146972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003643] [ENSMUST00000085715] [ENSMUST00000208710] [ENSMUST00000209058]
AlphaFold P07310
Predicted Effect possibly damaging
Transcript: ENSMUST00000003643
AA Change: K250E

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003643
Gene: ENSMUSG00000030399
AA Change: K250E

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 24 99 5.2e-38 PFAM
Pfam:ATP-gua_Ptrans 120 367 2.6e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000047020
SMART Domains Protein: ENSMUSP00000043987
Gene: ENSMUSG00000040705

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085715
SMART Domains Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397

DomainStartEndE-ValueType
S_TKc 59 310 1.4e-109 SMART
UBA 331 368 9.62e-8 SMART
low complexity region 391 408 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
low complexity region 580 586 N/A INTRINSIC
low complexity region 672 690 N/A INTRINSIC
Pfam:KA1 709 752 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208685
Predicted Effect probably damaging
Transcript: ENSMUST00000208710
AA Change: K319E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209058
Meta Mutation Damage Score 0.7495 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis and is an important serum marker for myocardial infarction. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in striated muscle as well as in other tissues, and as a heterodimer with a similar brain isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in function and energy utilization of both skeletal and cardiac muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chd3 G T 11: 69,240,703 (GRCm39) R1579S probably benign Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Foxi1 A G 11: 34,157,972 (GRCm39) F18L probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Rnf26rt C T 6: 76,473,792 (GRCm39) V275I probably benign Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Slc6a12 T A 6: 121,330,489 (GRCm39) probably null Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss11a C T 5: 86,568,055 (GRCm39) R224K probably damaging Het
Tmprss15 C T 16: 78,754,244 (GRCm39) S988N probably benign Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Ugt1a10 T A 1: 87,983,919 (GRCm39) V239E probably damaging Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Ckm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Ckm APN 7 19,150,712 (GRCm39) nonsense probably null
IGL01486:Ckm APN 7 19,155,156 (GRCm39) missense probably damaging 1.00
IGL03303:Ckm APN 7 19,148,263 (GRCm39) splice site probably benign
R0382:Ckm UTSW 7 19,155,309 (GRCm39) makesense probably null
R0505:Ckm UTSW 7 19,153,377 (GRCm39) nonsense probably null
R2042:Ckm UTSW 7 19,148,082 (GRCm39) missense possibly damaging 0.49
R2157:Ckm UTSW 7 19,155,279 (GRCm39) missense probably benign 0.00
R4257:Ckm UTSW 7 19,155,279 (GRCm39) missense probably benign 0.00
R4663:Ckm UTSW 7 19,153,419 (GRCm39) missense probably damaging 1.00
R5327:Ckm UTSW 7 19,154,090 (GRCm39) missense probably damaging 1.00
R5788:Ckm UTSW 7 19,153,372 (GRCm39) missense probably benign 0.08
R6995:Ckm UTSW 7 19,154,156 (GRCm39) missense probably benign 0.03
R7212:Ckm UTSW 7 19,148,978 (GRCm39) critical splice donor site probably null
R9313:Ckm UTSW 7 19,149,398 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGTCCAATTCCTGGTGTCC -3'
(R):5'- ACCCCATTCCATTTACAGGTAGAG -3'

Sequencing Primer
(F):5'- CCCTTTCTCAGATTGAGGAGATC -3'
(R):5'- CCATTTACAGGTAGAGAATCTGAGCC -3'
Posted On 2015-08-18