Incidental Mutation 'R4515:Ckm'
ID332851
Institutional Source Beutler Lab
Gene Symbol Ckm
Ensembl Gene ENSMUSG00000030399
Gene Namecreatine kinase, muscle
SynonymsM-CK, MCK, Ckmm
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19404776-19422841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19420284 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 319 (K319E)
Ref Sequence ENSEMBL: ENSMUSP00000146972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003643] [ENSMUST00000085715] [ENSMUST00000208710] [ENSMUST00000209058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003643
AA Change: K250E

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003643
Gene: ENSMUSG00000030399
AA Change: K250E

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 24 99 5.2e-38 PFAM
Pfam:ATP-gua_Ptrans 120 367 2.6e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000047020
SMART Domains Protein: ENSMUSP00000043987
Gene: ENSMUSG00000040705

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085715
SMART Domains Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397

DomainStartEndE-ValueType
S_TKc 59 310 1.4e-109 SMART
UBA 331 368 9.62e-8 SMART
low complexity region 391 408 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
low complexity region 580 586 N/A INTRINSIC
low complexity region 672 690 N/A INTRINSIC
Pfam:KA1 709 752 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208685
Predicted Effect probably damaging
Transcript: ENSMUST00000208710
AA Change: K319E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209058
Meta Mutation Damage Score 0.7495 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis and is an important serum marker for myocardial infarction. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in striated muscle as well as in other tissues, and as a heterodimer with a similar brain isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in function and energy utilization of both skeletal and cardiac muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Ckm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Ckm APN 7 19416787 nonsense probably null
IGL01486:Ckm APN 7 19421231 missense probably damaging 1.00
IGL03303:Ckm APN 7 19414338 splice site probably benign
R0382:Ckm UTSW 7 19421384 makesense probably null
R0505:Ckm UTSW 7 19419452 nonsense probably null
R2042:Ckm UTSW 7 19414157 missense possibly damaging 0.49
R2157:Ckm UTSW 7 19421354 missense probably benign 0.00
R4257:Ckm UTSW 7 19421354 missense probably benign 0.00
R4663:Ckm UTSW 7 19419494 missense probably damaging 1.00
R5327:Ckm UTSW 7 19420165 missense probably damaging 1.00
R5788:Ckm UTSW 7 19419447 missense probably benign 0.08
R6995:Ckm UTSW 7 19420231 missense probably benign 0.03
R7212:Ckm UTSW 7 19415053 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTCCAATTCCTGGTGTCC -3'
(R):5'- ACCCCATTCCATTTACAGGTAGAG -3'

Sequencing Primer
(F):5'- CCCTTTCTCAGATTGAGGAGATC -3'
(R):5'- CCATTTACAGGTAGAGAATCTGAGCC -3'
Posted On2015-08-18