Incidental Mutation 'R4515:Chrnb3'
ID332855
Institutional Source Beutler Lab
Gene Symbol Chrnb3
Ensembl Gene ENSMUSG00000031492
Gene Namecholinergic receptor, nicotinic, beta polypeptide 3
SynonymsAcrb3, 5730417K16Rik
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27368711-27399730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27385090 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 39 (L39P)
Ref Sequence ENSEMBL: ENSMUSP00000147672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060943] [ENSMUST00000079463] [ENSMUST00000211104]
Predicted Effect probably damaging
Transcript: ENSMUST00000060943
AA Change: L39P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052297
Gene: ENSMUSG00000031492
AA Change: L39P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 239 2.3e-75 PFAM
Pfam:Neur_chan_memb 246 452 1.9e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079463
AA Change: L39P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078428
Gene: ENSMUSG00000031492
AA Change: L39P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 224 1.3e-57 PFAM
Pfam:Neur_chan_memb 231 374 4.3e-48 PFAM
Pfam:Neur_chan_memb 349 437 9.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211104
AA Change: L39P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7751 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that make up the muscle and neuronal forms of nAChRs are encoded by separate genes and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]). Elliott et al. (1996) [PubMed 8906617] stated that the proposed structure for each subunit is a conserved N-terminal extracellular domain followed by 3 conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region.[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperactivity and reflex abnormalities but were otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Chrnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chrnb3 APN 8 27385101 missense probably benign 0.13
IGL01655:Chrnb3 APN 8 27394174 missense probably damaging 1.00
IGL02124:Chrnb3 APN 8 27396804 unclassified probably benign
IGL02403:Chrnb3 APN 8 27393808 missense probably damaging 1.00
IGL02474:Chrnb3 APN 8 27393369 missense probably damaging 1.00
IGL02903:Chrnb3 APN 8 27386806 missense probably damaging 0.96
R0178:Chrnb3 UTSW 8 27393364 missense probably damaging 1.00
R0736:Chrnb3 UTSW 8 27385050 missense probably benign 0.00
R1695:Chrnb3 UTSW 8 27393700 missense probably damaging 1.00
R2051:Chrnb3 UTSW 8 27386811 missense probably damaging 1.00
R2091:Chrnb3 UTSW 8 27394234 missense probably damaging 1.00
R2313:Chrnb3 UTSW 8 27393781 missense probably damaging 1.00
R3020:Chrnb3 UTSW 8 27396784 missense probably benign
R3981:Chrnb3 UTSW 8 27394006 missense probably damaging 1.00
R4236:Chrnb3 UTSW 8 27393993 missense probably damaging 1.00
R4276:Chrnb3 UTSW 8 27393751 missense probably damaging 1.00
R4422:Chrnb3 UTSW 8 27396733 missense possibly damaging 0.84
R4688:Chrnb3 UTSW 8 27394119 missense probably damaging 1.00
R4931:Chrnb3 UTSW 8 27394230 missense probably damaging 0.99
R5164:Chrnb3 UTSW 8 27394132 missense probably damaging 1.00
R6333:Chrnb3 UTSW 8 27393327 missense probably damaging 0.96
R6454:Chrnb3 UTSW 8 27393375 missense probably damaging 1.00
R7070:Chrnb3 UTSW 8 27393961 missense probably damaging 1.00
R8060:Chrnb3 UTSW 8 27394560 missense unknown
R8156:Chrnb3 UTSW 8 27393654 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGTAGAGTTCAGAGCACCTTGC -3'
(R):5'- GATTTCCGTTCAACACAGCC -3'

Sequencing Primer
(F):5'- ATGAAGGCTTCAGGTGTG -3'
(R):5'- AATGTCAGTGTCCGTGACAG -3'
Posted On2015-08-18