Mutagenetix > Incidental Mutations

Incidental Mutation 'R4515:Sipa1l2'

332858

Institutional Source

Beutler Lab

Gene Symbol

Sipa1l2

Ensembl Gene

ENSMUSG00000001995

Gene Name

signal-induced proliferation-associated 1 like 2

Synonyms

MMRRC Submission

041589-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.271) question?

Stock #

R4515 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125418063-125569808 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125492226 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 124 (D124G)

Ref Sequence

ENSEMBL: ENSMUSP00000148536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]

Predicted Effect

probably benign
Transcript: ENSMUST00000108775
AA Change: D124G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: D124G

Domain	Start	End	E-Value	Type
low complexity region	53	64	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	261	272	N/A	INTRINSIC
low complexity region	427	449	N/A	INTRINSIC
Pfam:Rap_GAP	625	807	2.6e-67	PFAM
PDZ	960	1026	6.47e-9	SMART
low complexity region	1091	1103	N/A	INTRINSIC
low complexity region	1120	1138	N/A	INTRINSIC
low complexity region	1220	1238	N/A	INTRINSIC
low complexity region	1299	1312	N/A	INTRINSIC
low complexity region	1321	1329	N/A	INTRINSIC
low complexity region	1334	1355	N/A	INTRINSIC
low complexity region	1404	1418	N/A	INTRINSIC
Pfam:SPAR_C	1421	1666	2.5e-76	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212168
AA Change: D124G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000212987
AA Change: D124G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (65/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	G	T	5: 138,647,744	K630N	probably damaging	Het
Acss2	C	A	2: 155,556,363	L335I	probably benign	Het
Alg6	A	T	4: 99,752,786		probably benign	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Bsn	G	T	9: 108,104,078		probably null	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cdhr4	G	A	9: 107,992,951	E52K	probably benign	Het
Ces1a	T	A	8: 93,020,904	N500Y	probably damaging	Het
Chd3	G	T	11: 69,349,877	R1579S	probably benign	Het
Chrnb3	T	C	8: 27,385,090	L39P	probably damaging	Het
Ckm	A	G	7: 19,420,284	K319E	probably damaging	Het
Cnot6	C	T	11: 49,702,536		probably null	Het
Copg1	A	G	6: 87,907,546		probably benign	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnah2	A	G	11: 69,465,631	S2135P	possibly damaging	Het
Dsg2	C	A	18: 20,601,387	D807E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxi1	A	G	11: 34,207,972	F18L	probably damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Glod4	T	A	11: 76,243,571	D25V	probably damaging	Het
Gm11492	A	G	11: 87,568,057	H419R	probably benign	Het
Gm9008	C	T	6: 76,496,809	V275I	probably benign	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
H2-M10.3	C	T	17: 36,367,830		probably null	Het
Hemgn	T	C	4: 46,396,477	E253G	probably damaging	Het
Itsn1	G	A	16: 91,899,649	V47M	probably damaging	Het
Kif5b	A	G	18: 6,208,257	V947A	probably benign	Het
Kif9	A	G	9: 110,489,867	H133R	probably benign	Het
Lce1l	T	C	3: 92,850,474	T26A	unknown	Het
Macf1	T	C	4: 123,493,988	E1172G	probably damaging	Het
Nkx3-2	C	T	5: 41,763,938	V3M	probably damaging	Het
Nr2e1	G	A	10: 42,578,191	T49I	probably benign	Het
Oc90	A	G	15: 65,892,393	L138P	probably damaging	Het
Olfr834	T	G	9: 18,987,982		probably null	Het
Olfr954	C	T	9: 39,462,231	R264*	probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Paqr3	T	A	5: 97,103,361	N168I	possibly damaging	Het
Pcdhac1	T	A	18: 37,091,379	I415N	probably damaging	Het
Pdik1l	T	C	4: 134,278,896	N75S	probably damaging	Het
Pik3r4	A	G	9: 105,672,725	H1005R	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Prkch	A	G	12: 73,702,838	T402A	possibly damaging	Het
Ptger4	C	A	15: 5,242,379	R253L	probably damaging	Het
Rabac1	A	T	7: 24,970,160	Y173*	probably null	Het
Rapsn	G	A	2: 91,043,212	V288M	possibly damaging	Het
Sec31a	A	G	5: 100,365,958	S993P	probably damaging	Het
Serpina9	T	A	12: 104,001,294	M281L	probably benign	Het
Serpine1	G	A	5: 137,069,468	A117V	probably damaging	Het
Sh3tc2	A	G	18: 61,987,693		probably null	Het
Slc6a12	T	A	6: 121,353,530		probably null	Het
Stk11	A	G	10: 80,116,601		probably benign	Het
Tcaf3	A	G	6: 42,589,996	Y720H	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,196	R224K	probably damaging	Het
Tmprss15	C	T	16: 78,957,356	S988N	probably benign	Het
Txn2	A	T	15: 77,915,443		probably null	Het
Ugt1a10	T	A	1: 88,056,197	V239E	probably damaging	Het
Vmn2r102	A	G	17: 19,681,213	Y534C	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het

Other mutations in Sipa1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Sipa1l2	APN	8	125491806	missense	probably damaging	1.00
IGL00939:Sipa1l2	APN	8	125464435	splice site	probably benign
IGL00965:Sipa1l2	APN	8	125447874	missense	probably benign	0.02
IGL01321:Sipa1l2	APN	8	125491518	missense	probably damaging	1.00
IGL01450:Sipa1l2	APN	8	125422577	critical splice donor site	probably null
IGL01753:Sipa1l2	APN	8	125453292	splice site	probably benign
IGL01930:Sipa1l2	APN	8	125419239	missense	probably damaging	0.99
IGL02041:Sipa1l2	APN	8	125491819	missense	probably benign	0.03
IGL02215:Sipa1l2	APN	8	125447837	missense	possibly damaging	0.67
IGL02272:Sipa1l2	APN	8	125492011	missense	probably damaging	1.00
IGL02370:Sipa1l2	APN	8	125480269	missense	probably damaging	1.00
IGL02538:Sipa1l2	APN	8	125451977	missense	probably damaging	1.00
IGL02633:Sipa1l2	APN	8	125447768	missense	probably damaging	1.00
IGL03394:Sipa1l2	APN	8	125491659	missense	possibly damaging	0.67
Rebellious	UTSW	8	125468339	missense	probably benign	0.01
R0144:Sipa1l2	UTSW	8	125449876	splice site	probably null
R0153:Sipa1l2	UTSW	8	125421898	missense	probably damaging	0.99
R0276:Sipa1l2	UTSW	8	125421940	missense	probably damaging	1.00
R0318:Sipa1l2	UTSW	8	125447697	missense	possibly damaging	0.73
R0373:Sipa1l2	UTSW	8	125464410	missense	probably damaging	0.99
R0427:Sipa1l2	UTSW	8	125480332	missense	probably damaging	1.00
R0634:Sipa1l2	UTSW	8	125422624	nonsense	probably null
R1377:Sipa1l2	UTSW	8	125491977	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1404:Sipa1l2	UTSW	8	125449973	missense	probably damaging	1.00
R1435:Sipa1l2	UTSW	8	125468725	missense	probably damaging	1.00
R1523:Sipa1l2	UTSW	8	125447613	missense	possibly damaging	0.75
R1577:Sipa1l2	UTSW	8	125492262	missense	probably benign	0.00
R1581:Sipa1l2	UTSW	8	125491617	missense	probably damaging	0.96
R1583:Sipa1l2	UTSW	8	125421895	missense	probably damaging	0.97
R1719:Sipa1l2	UTSW	8	125444535	missense	probably damaging	0.99
R1730:Sipa1l2	UTSW	8	125480141	splice site	probably null
R1940:Sipa1l2	UTSW	8	125480148	splice site	probably benign
R2007:Sipa1l2	UTSW	8	125439437	missense	probably damaging	1.00
R2141:Sipa1l2	UTSW	8	125491491	missense	probably benign	0.07
R2203:Sipa1l2	UTSW	8	125491627	missense	probably damaging	0.99
R2764:Sipa1l2	UTSW	8	125492374	missense	probably damaging	0.99
R3722:Sipa1l2	UTSW	8	125473584	missense	probably damaging	1.00
R3787:Sipa1l2	UTSW	8	125423205	missense	probably benign
R3787:Sipa1l2	UTSW	8	125450383	missense	possibly damaging	0.52
R4106:Sipa1l2	UTSW	8	125492308	missense	probably damaging	1.00
R4117:Sipa1l2	UTSW	8	125468510	missense	probably damaging	1.00
R4194:Sipa1l2	UTSW	8	125491672	missense	probably benign	0.00
R4237:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4240:Sipa1l2	UTSW	8	125491656	missense	probably benign	0.44
R4448:Sipa1l2	UTSW	8	125492355	missense	probably damaging	1.00
R4519:Sipa1l2	UTSW	8	125492226	missense	probably benign	0.00
R4523:Sipa1l2	UTSW	8	125492424	missense	probably damaging	1.00
R4557:Sipa1l2	UTSW	8	125464415	missense	probably damaging	0.98
R4667:Sipa1l2	UTSW	8	125453470	missense	possibly damaging	0.93
R4687:Sipa1l2	UTSW	8	125491245	missense	probably damaging	1.00
R4854:Sipa1l2	UTSW	8	125473601	missense	probably damaging	1.00
R4890:Sipa1l2	UTSW	8	125491867	missense	probably damaging	1.00
R5065:Sipa1l2	UTSW	8	125491585	missense	probably benign	0.19
R5194:Sipa1l2	UTSW	8	125439273	missense	possibly damaging	0.48
R5266:Sipa1l2	UTSW	8	125492126	missense	probably damaging	0.99
R5475:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R5718:Sipa1l2	UTSW	8	125491248	missense	probably damaging	1.00
R5910:Sipa1l2	UTSW	8	125491684	missense	probably benign	0.42
R5916:Sipa1l2	UTSW	8	125468573	missense	probably damaging	1.00
R5941:Sipa1l2	UTSW	8	125473536	missense	probably damaging	0.99
R6083:Sipa1l2	UTSW	8	125468473	missense	possibly damaging	0.87
R6185:Sipa1l2	UTSW	8	125468253	nonsense	probably null
R6235:Sipa1l2	UTSW	8	125474871	missense	probably damaging	1.00
R6274:Sipa1l2	UTSW	8	125469872	missense	probably damaging	1.00
R6299:Sipa1l2	UTSW	8	125453464	missense	possibly damaging	0.75
R6374:Sipa1l2	UTSW	8	125444630	missense	probably damaging	1.00
R6459:Sipa1l2	UTSW	8	125444484	critical splice donor site	probably null
R6462:Sipa1l2	UTSW	8	125491230	missense	probably damaging	1.00
R6496:Sipa1l2	UTSW	8	125449894	missense	probably benign	0.00
R6543:Sipa1l2	UTSW	8	125450362	missense	possibly damaging	0.50
R7154:Sipa1l2	UTSW	8	125468339	missense	probably benign	0.01
R7192:Sipa1l2	UTSW	8	125422609	missense	probably benign	0.09
R7240:Sipa1l2	UTSW	8	125469860	missense	probably damaging	1.00
R7361:Sipa1l2	UTSW	8	125453332	missense	probably damaging	1.00
R7383:Sipa1l2	UTSW	8	125447646	missense	probably damaging	1.00
R7417:Sipa1l2	UTSW	8	125482106	missense	possibly damaging	0.93
R7604:Sipa1l2	UTSW	8	125419272	missense	probably benign	0.45
R7658:Sipa1l2	UTSW	8	125492290	missense	probably benign	0.00
R7743:Sipa1l2	UTSW	8	125464233	missense	probably damaging	1.00
R7781:Sipa1l2	UTSW	8	125491827	missense	possibly damaging	0.46
R7812:Sipa1l2	UTSW	8	125491595	missense	probably damaging	1.00
R7829:Sipa1l2	UTSW	8	125451988	missense	probably damaging	1.00
R7880:Sipa1l2	UTSW	8	125464393	missense	probably damaging	1.00
R7884:Sipa1l2	UTSW	8	125447598	missense	probably benign
R8057:Sipa1l2	UTSW	8	125468530	missense	probably damaging	1.00
R8082:Sipa1l2	UTSW	8	125491809	missense	possibly damaging	0.82
R8092:Sipa1l2	UTSW	8	125419168	missense	probably benign	0.03
R8247:Sipa1l2	UTSW	8	125422633	missense	probably benign	0.29
R8252:Sipa1l2	UTSW	8	125468671	missense	probably damaging	1.00
R8386:Sipa1l2	UTSW	8	125492093	missense	probably damaging	1.00
R8466:Sipa1l2	UTSW	8	125492246	missense	probably damaging	1.00
R8697:Sipa1l2	UTSW	8	125482116	missense	probably damaging	1.00
R8725:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
R8727:Sipa1l2	UTSW	8	125450386	missense	probably benign	0.28
X0027:Sipa1l2	UTSW	8	125492136	missense	probably damaging	1.00
Z1177:Sipa1l2	UTSW	8	125447556	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- ATGAAGTGCTCCCATACTCCC -3'
(R):5'- ACTTCCAGTTCGAGTGAGGG -3'

Sequencing Primer
(F):5'- GCTCCCATACTCCCTGTGCAG -3'
(R):5'- CAGTTCGAGTGAGGGCGGAG -3'

Posted On

2015-08-18