Incidental Mutation 'R4515:Olfr834'
ID332859
Institutional Source Beutler Lab
Gene Symbol Olfr834
Ensembl Gene ENSMUSG00000095525
Gene Nameolfactory receptor 834
SynonymsMOR153-2, GA_x6K02T2PVTD-12724921-12725859, MOR153-4_p
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location18987990-18988928 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 18987982 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086492]
Predicted Effect probably null
Transcript: ENSMUST00000086492
SMART Domains Protein: ENSMUSP00000083680
Gene: ENSMUSG00000095525

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7e-6 PFAM
Pfam:7tm_1 41 290 2.9e-20 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Olfr834
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr834 APN 9 18988840 missense probably benign 0.16
IGL02073:Olfr834 APN 9 18988325 missense possibly damaging 0.89
IGL02119:Olfr834 APN 9 18988612 missense probably benign 0.00
IGL02705:Olfr834 APN 9 18988400 missense probably benign 0.03
R0462:Olfr834 UTSW 9 18988902 missense probably benign
R0466:Olfr834 UTSW 9 18988255 missense probably benign 0.00
R0709:Olfr834 UTSW 9 18988126 missense probably damaging 0.98
R0711:Olfr834 UTSW 9 18988151 missense probably benign 0.04
R1268:Olfr834 UTSW 9 18988356 missense probably damaging 0.98
R1663:Olfr834 UTSW 9 18988710 missense probably damaging 0.99
R1680:Olfr834 UTSW 9 18988516 missense possibly damaging 0.81
R1686:Olfr834 UTSW 9 18988543 missense probably damaging 1.00
R1903:Olfr834 UTSW 9 18988896 nonsense probably null
R1907:Olfr834 UTSW 9 18988441 missense possibly damaging 0.82
R1911:Olfr834 UTSW 9 18988900 missense probably damaging 0.99
R2143:Olfr834 UTSW 9 18988803 missense probably benign 0.06
R2431:Olfr834 UTSW 9 18988003 missense probably damaging 1.00
R4014:Olfr834 UTSW 9 18988882 missense probably benign 0.08
R4575:Olfr834 UTSW 9 18988705 nonsense probably null
R6974:Olfr834 UTSW 9 18988393 missense probably damaging 0.99
R7394:Olfr834 UTSW 9 18988710 missense probably damaging 0.99
R7455:Olfr834 UTSW 9 18988854 missense possibly damaging 0.92
R7828:Olfr834 UTSW 9 18988920 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGTGTTGGTTAACCTAGTTCCTC -3'
(R):5'- ACCAGCATTTTGGGGATGG -3'

Sequencing Primer
(F):5'- AAGTAGAATTACTCTGTTCCAACATG -3'
(R):5'- TGGTGGTAGTGAAACATATGTCAATG -3'
Posted On2015-08-18