Mutagenetix > Incidental Mutation

Incidental Mutation 'R0105:Psmb9'

33286

Institutional Source

Beutler Lab

Gene Symbol

Psmb9

Ensembl Gene

ENSMUSG00000096727

Gene Name

proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)

Synonyms

Lmp-2, Lmp2

MMRRC Submission

038391-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.241) question?

Stock #

R0105 (G1)

Quality Score

163

Status

Validated (trace)

Chromosome

Chromosomal Location

34401006-34406347 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34406249 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 12 (F12S)

Ref Sequence

ENSEMBL: ENSMUSP00000133499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000174576] [ENSMUST00000173831] [ENSMUST00000171321]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041633

SMART Domains

Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
transmembrane domain	116	138	N/A	INTRINSIC
Pfam:ABC_membrane	163	420	9.1e-55	PFAM
AAA	478	666	2.21e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166287

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168351

Predicted Effect

probably benign
Transcript: ENSMUST00000170086

SMART Domains

Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
transmembrane domain	116	138	N/A	INTRINSIC
Pfam:ABC_membrane	163	434	5.8e-70	PFAM
AAA	506	694	2.21e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171148

SMART Domains

Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	1	114	1.5e-24	PFAM
Pfam:ABC_tran	167	196	1e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174576
AA Change: F12S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133499
Gene: ENSMUSG00000096727
AA Change: F12S

Domain	Start	End	E-Value	Type
Pfam:Proteasome	17	198	1.2e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179593

Predicted Effect

probably benign
Transcript: ENSMUST00000173831

SMART Domains

Protein: ENSMUSP00000134120
Gene: ENSMUSG00000096727

Domain	Start	End	E-Value	Type
Pfam:Proteasome	1	64	2.3e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171321

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a grossly normal phenotype but suffer from increased susceptibility to some viruses and have an increased risk of tumor development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5530400C23Rik	G	A	6: 133,271,277 (GRCm39)	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,379,137 (GRCm39)		noncoding transcript	Het
Adcy9	A	G	16: 4,106,252 (GRCm39)	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,271,438 (GRCm39)	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,779,819 (GRCm39)	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,030,064 (GRCm39)		probably benign	Het
C1qtnf4	T	A	2: 90,720,707 (GRCm39)	*327R	probably null	Het
C1s1	T	C	6: 124,518,277 (GRCm39)		probably benign	Het
Cdsn	A	C	17: 35,867,035 (GRCm39)	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,563,384 (GRCm39)	M848V	probably benign	Het
Cog3	A	G	14: 75,959,580 (GRCm39)	S591P	probably damaging	Het
Col6a3	A	G	1: 90,725,883 (GRCm39)	V1375A	possibly damaging	Het
Cplane1	T	A	15: 8,216,876 (GRCm39)	V698D	probably benign	Het
Cr1l	A	G	1: 194,794,720 (GRCm39)		probably benign	Het
Crmp1	T	A	5: 37,441,479 (GRCm39)	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,807,801 (GRCm39)		probably benign	Het
Dnah6	C	T	6: 73,132,262 (GRCm39)	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,735,111 (GRCm39)	S1030P	probably benign	Het
Elavl3	C	A	9: 21,948,129 (GRCm39)	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,518,140 (GRCm39)	E218G	probably damaging	Het
Fam227a	T	C	15: 79,505,033 (GRCm39)	D466G	possibly damaging	Het
Fto	G	A	8: 92,249,430 (GRCm39)	E421K	probably damaging	Het
Gab2	T	C	7: 96,948,279 (GRCm39)	Y290H	probably damaging	Het
Gm973	A	G	1: 59,621,633 (GRCm39)	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,700,026 (GRCm39)	T249A	probably benign	Het
Il15ra	T	A	2: 11,735,459 (GRCm39)		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,481,734 (GRCm39)		probably benign	Het
Il6ra	A	G	3: 89,784,125 (GRCm39)	I382T	probably damaging	Het
Isy1	G	A	6: 87,796,167 (GRCm39)	R257W	probably damaging	Het
Krt76	T	C	15: 101,793,347 (GRCm39)	T564A	unknown	Het
Lhpp	T	C	7: 132,232,254 (GRCm39)	S57P	probably damaging	Het
Lrrk1	G	T	7: 65,942,089 (GRCm39)	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,335,368 (GRCm39)	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,500,307 (GRCm39)	T124A	probably benign	Het
Mroh7	T	C	4: 106,568,467 (GRCm39)	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,246,463 (GRCm39)	D33G	probably benign	Het
Neurog1	G	T	13: 56,399,050 (GRCm39)	D232E	probably benign	Het
Or4a71	T	C	2: 89,358,707 (GRCm39)	T16A	probably benign	Het
Or4c105	T	A	2: 88,648,253 (GRCm39)	V246D	probably damaging	Het
Otog	C	A	7: 45,937,790 (GRCm39)	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,302,682 (GRCm39)	H409N	probably benign	Het
Pik3r5	A	T	11: 68,381,337 (GRCm39)	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,593,956 (GRCm39)	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,345,325 (GRCm39)	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,537,473 (GRCm39)	R646K	possibly damaging	Het
Plekhg4	G	A	8: 106,108,644 (GRCm39)	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,674,210 (GRCm39)	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,103,323 (GRCm39)	E934*	probably null	Het
Ptdss2	T	C	7: 140,732,793 (GRCm39)	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,615,335 (GRCm39)		probably null	Het
Reln	G	A	5: 22,253,813 (GRCm39)	R600W	probably damaging	Het
Scml4	T	A	10: 42,806,595 (GRCm39)	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,431,478 (GRCm39)	T284S	probably benign	Het
Slc22a29	T	C	19: 8,137,991 (GRCm39)		probably benign	Het
Slc35e1	T	C	8: 73,246,415 (GRCm39)		probably benign	Het
Spen	T	C	4: 141,197,121 (GRCm39)		probably benign	Het
Sumf2	T	A	5: 129,878,735 (GRCm39)		probably benign	Het
Tbx10	A	G	19: 4,043,121 (GRCm39)		probably benign	Het
Tex10	C	A	4: 48,468,957 (GRCm39)	V73F	probably damaging	Het
Tgm5	C	A	2: 120,907,493 (GRCm39)	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,351,082 (GRCm39)		probably null	Het
Treml2	C	T	17: 48,609,856 (GRCm39)	T96I	probably damaging	Het
Trim65	T	C	11: 116,016,892 (GRCm39)	*523W	probably null	Het
Zcchc17	T	A	4: 130,243,099 (GRCm39)	D28V	probably benign	Het
Zhx2	T	C	15: 57,686,091 (GRCm39)	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,712,811 (GRCm39)	L248Q	probably damaging	Het

Other mutations in Psmb9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02008:Psmb9	APN	17	34,402,653 (GRCm39)	missense	probably damaging	1.00
bias	UTSW	17	34,402,199 (GRCm39)	nonsense	probably null
preconception	UTSW	17	34,402,588 (GRCm39)	critical splice donor site	probably null
R0021:Psmb9	UTSW	17	34,403,277 (GRCm39)	missense	probably benign	0.26
R0477:Psmb9	UTSW	17	34,401,238 (GRCm39)	missense	probably damaging	0.99
R3919:Psmb9	UTSW	17	34,402,588 (GRCm39)	critical splice donor site	probably null
R5898:Psmb9	UTSW	17	34,401,266 (GRCm39)	missense	probably damaging	0.97
R5943:Psmb9	UTSW	17	34,403,265 (GRCm39)	missense	probably damaging	0.99
R6408:Psmb9	UTSW	17	34,404,707 (GRCm39)	missense	probably damaging	1.00
R6919:Psmb9	UTSW	17	34,402,199 (GRCm39)	nonsense	probably null
R8512:Psmb9	UTSW	17	34,402,602 (GRCm39)	missense	probably benign
R9105:Psmb9	UTSW	17	34,401,905 (GRCm39)	intron	probably benign
R9304:Psmb9	UTSW	17	34,406,222 (GRCm39)	critical splice donor site	probably null
R9454:Psmb9	UTSW	17	34,402,078 (GRCm39)	missense	probably benign	0.00
R9633:Psmb9	UTSW	17	34,402,119 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGACGCTTCCAGCTCAAGCC -3'
(R):5'- TGCGTGAATTTTCCCATCCCAGG -3'

Sequencing Primer
(F):5'- GAACGCACCTTCTCACCAG -3'
(R):5'- AGGACCCTCTGTCGTCAC -3'

Posted On

2013-05-09