Incidental Mutation 'R4515:Nr2e1'
ID332866
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Namenuclear receptor subfamily 2, group E, member 1
SynonymsMtll, Tlx, tailless, Nr2e1
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R4515 (G1)
Quality Score157
Status Validated
Chromosome10
Chromosomal Location42561963-42583632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42578191 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 49 (T49I)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938]
Predicted Effect probably benign
Transcript: ENSMUST00000019938
AA Change: T49I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: T49I

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126848
SMART Domains Protein: ENSMUSP00000116439
Gene: ENSMUSG00000019803

DomainStartEndE-ValueType
ZnF_C4 9 82 2.04e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143891
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42568453 missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42567973 missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42567979 missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42571482 missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42568381 missense probably damaging 1.00
Dubious UTSW 10 42571487 nonsense probably null
BB010:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42567968 missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42582909 unclassified probably null
R1879:Nr2e1 UTSW 10 42568371 critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42572778 missense probably benign
R2426:Nr2e1 UTSW 10 42563485 missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42568445 missense probably damaging 0.99
R5305:Nr2e1 UTSW 10 42571487 nonsense probably null
R5316:Nr2e1 UTSW 10 42571491 missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42572784 missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42572769 missense probably benign
R7040:Nr2e1 UTSW 10 42568378 missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42563479 missense probably damaging 1.00
R7765:Nr2e1 UTSW 10 42574437 missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R8158:Nr2e1 UTSW 10 42582885 missense probably benign 0.00
Z1177:Nr2e1 UTSW 10 42568427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACCGTGGGAGTTCTGAC -3'
(R):5'- GTCAGATTGCTTAGCATCTCGC -3'

Sequencing Primer
(F):5'- AGTTCTGACTCTCTCCTGTAAAC -3'
(R):5'- GCATCTCGCTCCCCCTC -3'
Posted On2015-08-18