Mutagenetix > Incidental Mutation

Incidental Mutation 'R4515:Atp8b3'

332868

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

041589-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R4515 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80523847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 984 (M984I)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: M984I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: M984I

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220326

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (65/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	G	T	5: 138,647,744	K630N	probably damaging	Het
Acss2	C	A	2: 155,556,363	L335I	probably benign	Het
Alg6	A	T	4: 99,752,786		probably benign	Het
Bsn	G	T	9: 108,104,078		probably null	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cdhr4	G	A	9: 107,992,951	E52K	probably benign	Het
Ces1a	T	A	8: 93,020,904	N500Y	probably damaging	Het
Chd3	G	T	11: 69,349,877	R1579S	probably benign	Het
Chrnb3	T	C	8: 27,385,090	L39P	probably damaging	Het
Ckm	A	G	7: 19,420,284	K319E	probably damaging	Het
Cnot6	C	T	11: 49,702,536		probably null	Het
Copg1	A	G	6: 87,907,546		probably benign	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnah2	A	G	11: 69,465,631	S2135P	possibly damaging	Het
Dsg2	C	A	18: 20,601,387	D807E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxi1	A	G	11: 34,207,972	F18L	probably damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Glod4	T	A	11: 76,243,571	D25V	probably damaging	Het
Gm11492	A	G	11: 87,568,057	H419R	probably benign	Het
Gm9008	C	T	6: 76,496,809	V275I	probably benign	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
H2-M10.3	C	T	17: 36,367,830		probably null	Het
Hemgn	T	C	4: 46,396,477	E253G	probably damaging	Het
Itsn1	G	A	16: 91,899,649	V47M	probably damaging	Het
Kif5b	A	G	18: 6,208,257	V947A	probably benign	Het
Kif9	A	G	9: 110,489,867	H133R	probably benign	Het
Lce1l	T	C	3: 92,850,474	T26A	unknown	Het
Macf1	T	C	4: 123,493,988	E1172G	probably damaging	Het
Nkx3-2	C	T	5: 41,763,938	V3M	probably damaging	Het
Nr2e1	G	A	10: 42,578,191	T49I	probably benign	Het
Oc90	A	G	15: 65,892,393	L138P	probably damaging	Het
Olfr834	T	G	9: 18,987,982		probably null	Het
Olfr954	C	T	9: 39,462,231	R264*	probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Paqr3	T	A	5: 97,103,361	N168I	possibly damaging	Het
Pcdhac1	T	A	18: 37,091,379	I415N	probably damaging	Het
Pdik1l	T	C	4: 134,278,896	N75S	probably damaging	Het
Pik3r4	A	G	9: 105,672,725	H1005R	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Prkch	A	G	12: 73,702,838	T402A	possibly damaging	Het
Ptger4	C	A	15: 5,242,379	R253L	probably damaging	Het
Rabac1	A	T	7: 24,970,160	Y173*	probably null	Het
Rapsn	G	A	2: 91,043,212	V288M	possibly damaging	Het
Sec31a	A	G	5: 100,365,958	S993P	probably damaging	Het
Serpina9	T	A	12: 104,001,294	M281L	probably benign	Het
Serpine1	G	A	5: 137,069,468	A117V	probably damaging	Het
Sh3tc2	A	G	18: 61,987,693		probably null	Het
Sipa1l2	T	C	8: 125,492,226	D124G	probably benign	Het
Slc6a12	T	A	6: 121,353,530		probably null	Het
Stk11	A	G	10: 80,116,601		probably benign	Het
Tcaf3	A	G	6: 42,589,996	Y720H	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,196	R224K	probably damaging	Het
Tmprss15	C	T	16: 78,957,356	S988N	probably benign	Het
Txn2	A	T	15: 77,915,443		probably null	Het
Ugt1a10	T	A	1: 88,056,197	V239E	probably damaging	Het
Vmn2r102	A	G	17: 19,681,213	Y534C	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGTGACTGACAGTAGGCTAGATATG -3'
(R):5'- GGGAACAAAGGCAGCTTCATC -3'

Sequencing Primer
(F):5'- GGCTAGATATGGCCACCAATAC -3'
(R):5'- GGCAGCTTCATCTCACATCTAAG -3'

Posted On

2015-08-18