Incidental Mutation 'R4515:Foxi1'
ID332870
Institutional Source Beutler Lab
Gene Symbol Foxi1
Ensembl Gene ENSMUSG00000047861
Gene Nameforkhead box I1
SynonymsHfh3, Fkh10, HFH-3
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location34204338-34208089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34207972 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 18 (F18L)
Ref Sequence ENSEMBL: ENSMUSP00000058651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060271]
Predicted Effect probably damaging
Transcript: ENSMUST00000060271
AA Change: F18L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058651
Gene: ENSMUSG00000047861
AA Change: F18L

DomainStartEndE-ValueType
FH 115 205 3.76e-60 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 247 258 N/A INTRINSIC
Blast:FH 281 310 9e-8 BLAST
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors, which is characterized by a distinct forkhead domain. This gene may play an important role in the development of the cochlea and vestibulum, as well as in embryogenesis. The encoded protein has been found to be required for the transcription of four subunits of a proton pump found in the inner ear, the kidney, and the epididymis. Mutations in this gene have been associated with deafness, autosomal recessive 4. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes exhibit 50% perinatal lethality and inner ear defects resulting in vestibular and cochlear dysfunction. They are deaf with signs of impaired balance, and develop renal tubular acidosis in response to a chronic acidic load. Notably, 25% of heterozygotes die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Foxi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Foxi1 APN 11 34205772 missense probably benign 0.17
IGL01374:Foxi1 APN 11 34207984 missense probably damaging 1.00
IGL01397:Foxi1 APN 11 34207599 missense probably damaging 1.00
IGL02626:Foxi1 APN 11 34205860 missense probably benign 0.00
R1339:Foxi1 UTSW 11 34205866 missense probably benign
R1771:Foxi1 UTSW 11 34207594 missense probably damaging 1.00
R1864:Foxi1 UTSW 11 34207531 missense probably damaging 1.00
R1869:Foxi1 UTSW 11 34207937 missense possibly damaging 0.61
R1870:Foxi1 UTSW 11 34207937 missense possibly damaging 0.61
R1871:Foxi1 UTSW 11 34207937 missense possibly damaging 0.61
R4662:Foxi1 UTSW 11 34207578 missense probably damaging 1.00
R6280:Foxi1 UTSW 11 34207972 missense probably damaging 1.00
R7140:Foxi1 UTSW 11 34205758 missense probably damaging 1.00
R7268:Foxi1 UTSW 11 34205783 nonsense probably null
Z1176:Foxi1 UTSW 11 34207488 missense probably damaging 1.00
Z1177:Foxi1 UTSW 11 34207710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAATATGGTGGGCGTACC -3'
(R):5'- TTAGTGGGAACTAAGGCCACAG -3'

Sequencing Primer
(F):5'- TGGGCGTACCAGCTTCATGAG -3'
(R):5'- CCACAGGCAGCTAAGGC -3'
Posted On2015-08-18