Mutagenetix > Incidental Mutations

Incidental Mutation 'R4515:Foxi1'

332870

Institutional Source

Beutler Lab

Gene Symbol

Foxi1

Ensembl Gene

ENSMUSG00000047861

Gene Name

forkhead box I1

Synonyms

Hfh3, Fkh10, HFH-3

MMRRC Submission

041589-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.292) question?

Stock #

R4515 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34204338-34208089 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34207972 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 18 (F18L)

Ref Sequence

ENSEMBL: ENSMUSP00000058651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060271]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060271
AA Change: F18L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058651
Gene: ENSMUSG00000047861
AA Change: F18L

Domain	Start	End	E-Value	Type
FH	115	205	3.76e-60	SMART
low complexity region	207	227	N/A	INTRINSIC
low complexity region	247	258	N/A	INTRINSIC
Blast:FH	281	310	9e-8	BLAST

Meta Mutation Damage Score

0.0836

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (65/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors, which is characterized by a distinct forkhead domain. This gene may play an important role in the development of the cochlea and vestibulum, as well as in embryogenesis. The encoded protein has been found to be required for the transcription of four subunits of a proton pump found in the inner ear, the kidney, and the epididymis. Mutations in this gene have been associated with deafness, autosomal recessive 4. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes exhibit 50% perinatal lethality and inner ear defects resulting in vestibular and cochlear dysfunction. They are deaf with signs of impaired balance, and develop renal tubular acidosis in response to a chronic acidic load. Notably, 25% of heterozygotes die at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	G	T	5: 138,647,744	K630N	probably damaging	Het
Acss2	C	A	2: 155,556,363	L335I	probably benign	Het
Alg6	A	T	4: 99,752,786		probably benign	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Bsn	G	T	9: 108,104,078		probably null	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cdhr4	G	A	9: 107,992,951	E52K	probably benign	Het
Ces1a	T	A	8: 93,020,904	N500Y	probably damaging	Het
Chd3	G	T	11: 69,349,877	R1579S	probably benign	Het
Chrnb3	T	C	8: 27,385,090	L39P	probably damaging	Het
Ckm	A	G	7: 19,420,284	K319E	probably damaging	Het
Cnot6	C	T	11: 49,702,536		probably null	Het
Copg1	A	G	6: 87,907,546		probably benign	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnah2	A	G	11: 69,465,631	S2135P	possibly damaging	Het
Dsg2	C	A	18: 20,601,387	D807E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Glod4	T	A	11: 76,243,571	D25V	probably damaging	Het
Gm11492	A	G	11: 87,568,057	H419R	probably benign	Het
Gm9008	C	T	6: 76,496,809	V275I	probably benign	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
H2-M10.3	C	T	17: 36,367,830		probably null	Het
Hemgn	T	C	4: 46,396,477	E253G	probably damaging	Het
Itsn1	G	A	16: 91,899,649	V47M	probably damaging	Het
Kif5b	A	G	18: 6,208,257	V947A	probably benign	Het
Kif9	A	G	9: 110,489,867	H133R	probably benign	Het
Lce1l	T	C	3: 92,850,474	T26A	unknown	Het
Macf1	T	C	4: 123,493,988	E1172G	probably damaging	Het
Nkx3-2	C	T	5: 41,763,938	V3M	probably damaging	Het
Nr2e1	G	A	10: 42,578,191	T49I	probably benign	Het
Oc90	A	G	15: 65,892,393	L138P	probably damaging	Het
Olfr834	T	G	9: 18,987,982		probably null	Het
Olfr954	C	T	9: 39,462,231	R264*	probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Paqr3	T	A	5: 97,103,361	N168I	possibly damaging	Het
Pcdhac1	T	A	18: 37,091,379	I415N	probably damaging	Het
Pdik1l	T	C	4: 134,278,896	N75S	probably damaging	Het
Pik3r4	A	G	9: 105,672,725	H1005R	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Prkch	A	G	12: 73,702,838	T402A	possibly damaging	Het
Ptger4	C	A	15: 5,242,379	R253L	probably damaging	Het
Rabac1	A	T	7: 24,970,160	Y173*	probably null	Het
Rapsn	G	A	2: 91,043,212	V288M	possibly damaging	Het
Sec31a	A	G	5: 100,365,958	S993P	probably damaging	Het
Serpina9	T	A	12: 104,001,294	M281L	probably benign	Het
Serpine1	G	A	5: 137,069,468	A117V	probably damaging	Het
Sh3tc2	A	G	18: 61,987,693		probably null	Het
Sipa1l2	T	C	8: 125,492,226	D124G	probably benign	Het
Slc6a12	T	A	6: 121,353,530		probably null	Het
Stk11	A	G	10: 80,116,601		probably benign	Het
Tcaf3	A	G	6: 42,589,996	Y720H	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,196	R224K	probably damaging	Het
Tmprss15	C	T	16: 78,957,356	S988N	probably benign	Het
Txn2	A	T	15: 77,915,443		probably null	Het
Ugt1a10	T	A	1: 88,056,197	V239E	probably damaging	Het
Vmn2r102	A	G	17: 19,681,213	Y534C	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het

Other mutations in Foxi1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Foxi1	APN	11	34205772	missense	probably benign	0.17
IGL01374:Foxi1	APN	11	34207984	missense	probably damaging	1.00
IGL01397:Foxi1	APN	11	34207599	missense	probably damaging	1.00
IGL02626:Foxi1	APN	11	34205860	missense	probably benign	0.00
R1339:Foxi1	UTSW	11	34205866	missense	probably benign
R1771:Foxi1	UTSW	11	34207594	missense	probably damaging	1.00
R1864:Foxi1	UTSW	11	34207531	missense	probably damaging	1.00
R1869:Foxi1	UTSW	11	34207937	missense	possibly damaging	0.61
R1870:Foxi1	UTSW	11	34207937	missense	possibly damaging	0.61
R1871:Foxi1	UTSW	11	34207937	missense	possibly damaging	0.61
R4662:Foxi1	UTSW	11	34207578	missense	probably damaging	1.00
R6280:Foxi1	UTSW	11	34207972	missense	probably damaging	1.00
R7140:Foxi1	UTSW	11	34205758	missense	probably damaging	1.00
R7268:Foxi1	UTSW	11	34205783	nonsense	probably null
R8379:Foxi1	UTSW	11	34207530	missense	possibly damaging	0.94
Z1176:Foxi1	UTSW	11	34207488	missense	probably damaging	1.00
Z1177:Foxi1	UTSW	11	34207710	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAATATGGTGGGCGTACC -3'
(R):5'- TTAGTGGGAACTAAGGCCACAG -3'

Sequencing Primer
(F):5'- TGGGCGTACCAGCTTCATGAG -3'
(R):5'- CCACAGGCAGCTAAGGC -3'

Posted On

2015-08-18