Incidental Mutation 'R4515:Foxi1'
ID 332870
Institutional Source Beutler Lab
Gene Symbol Foxi1
Ensembl Gene ENSMUSG00000047861
Gene Name forkhead box I1
Synonyms Hfh3, HFH-3, Fkh10
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.250) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 34154341-34158089 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34157972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 18 (F18L)
Ref Sequence ENSEMBL: ENSMUSP00000058651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060271]
AlphaFold Q922I5
Predicted Effect probably damaging
Transcript: ENSMUST00000060271
AA Change: F18L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058651
Gene: ENSMUSG00000047861
AA Change: F18L

DomainStartEndE-ValueType
FH 115 205 3.76e-60 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 247 258 N/A INTRINSIC
Blast:FH 281 310 9e-8 BLAST
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors, which is characterized by a distinct forkhead domain. This gene may play an important role in the development of the cochlea and vestibulum, as well as in embryogenesis. The encoded protein has been found to be required for the transcription of four subunits of a proton pump found in the inner ear, the kidney, and the epididymis. Mutations in this gene have been associated with deafness, autosomal recessive 4. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes exhibit 50% perinatal lethality and inner ear defects resulting in vestibular and cochlear dysfunction. They are deaf with signs of impaired balance, and develop renal tubular acidosis in response to a chronic acidic load. Notably, 25% of heterozygotes die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chd3 G T 11: 69,240,703 (GRCm39) R1579S probably benign Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Ckm A G 7: 19,154,209 (GRCm39) K319E probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Rnf26rt C T 6: 76,473,792 (GRCm39) V275I probably benign Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Slc6a12 T A 6: 121,330,489 (GRCm39) probably null Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss11a C T 5: 86,568,055 (GRCm39) R224K probably damaging Het
Tmprss15 C T 16: 78,754,244 (GRCm39) S988N probably benign Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Ugt1a10 T A 1: 87,983,919 (GRCm39) V239E probably damaging Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Foxi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Foxi1 APN 11 34,155,772 (GRCm39) missense probably benign 0.17
IGL01374:Foxi1 APN 11 34,157,984 (GRCm39) missense probably damaging 1.00
IGL01397:Foxi1 APN 11 34,157,599 (GRCm39) missense probably damaging 1.00
IGL02626:Foxi1 APN 11 34,155,860 (GRCm39) missense probably benign 0.00
R1339:Foxi1 UTSW 11 34,155,866 (GRCm39) missense probably benign
R1771:Foxi1 UTSW 11 34,157,594 (GRCm39) missense probably damaging 1.00
R1864:Foxi1 UTSW 11 34,157,531 (GRCm39) missense probably damaging 1.00
R1869:Foxi1 UTSW 11 34,157,937 (GRCm39) missense possibly damaging 0.61
R1870:Foxi1 UTSW 11 34,157,937 (GRCm39) missense possibly damaging 0.61
R1871:Foxi1 UTSW 11 34,157,937 (GRCm39) missense possibly damaging 0.61
R4662:Foxi1 UTSW 11 34,157,578 (GRCm39) missense probably damaging 1.00
R6280:Foxi1 UTSW 11 34,157,972 (GRCm39) missense probably damaging 1.00
R7140:Foxi1 UTSW 11 34,155,758 (GRCm39) missense probably damaging 1.00
R7268:Foxi1 UTSW 11 34,155,783 (GRCm39) nonsense probably null
R8379:Foxi1 UTSW 11 34,157,530 (GRCm39) missense possibly damaging 0.94
R9443:Foxi1 UTSW 11 34,155,671 (GRCm39) missense probably benign 0.30
Z1176:Foxi1 UTSW 11 34,157,488 (GRCm39) missense probably damaging 1.00
Z1177:Foxi1 UTSW 11 34,157,710 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAATATGGTGGGCGTACC -3'
(R):5'- TTAGTGGGAACTAAGGCCACAG -3'

Sequencing Primer
(F):5'- TGGGCGTACCAGCTTCATGAG -3'
(R):5'- CCACAGGCAGCTAAGGC -3'
Posted On 2015-08-18