Mutagenetix > Incidental Mutations

Incidental Mutation 'R4515:Chd3'

332872

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

Chd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1

MMRRC Submission

041589-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4515 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69343273-69369406 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 69349877 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1579 (R1579S)

Ref Sequence

ENSEMBL: ENSMUSP00000104301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]

Predicted Effect

probably benign
Transcript: ENSMUST00000092971
AA Change: R1579S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: R1579S

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108661
AA Change: R1579S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: R1579S

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122992

Predicted Effect

unknown
Transcript: ENSMUST00000128981
AA Change: R1485S

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: R1485S

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135909

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146930

Predicted Effect

probably benign
Transcript: ENSMUST00000151436

SMART Domains

Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	142	9e-24	PFAM
SCOP:d1gkub2	162	197	1e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157256

Meta Mutation Damage Score

0.0672

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 97.1%
20x: 94.6%

Validation Efficiency

96% (65/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	G	T	5: 138,647,744	K630N	probably damaging	Het
Acss2	C	A	2: 155,556,363	L335I	probably benign	Het
Alg6	A	T	4: 99,752,786		probably benign	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Bsn	G	T	9: 108,104,078		probably null	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cdhr4	G	A	9: 107,992,951	E52K	probably benign	Het
Ces1a	T	A	8: 93,020,904	N500Y	probably damaging	Het
Chrnb3	T	C	8: 27,385,090	L39P	probably damaging	Het
Ckm	A	G	7: 19,420,284	K319E	probably damaging	Het
Cnot6	C	T	11: 49,702,536		probably null	Het
Copg1	A	G	6: 87,907,546		probably benign	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnah2	A	G	11: 69,465,631	S2135P	possibly damaging	Het
Dsg2	C	A	18: 20,601,387	D807E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxi1	A	G	11: 34,207,972	F18L	probably damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Glod4	T	A	11: 76,243,571	D25V	probably damaging	Het
Gm11492	A	G	11: 87,568,057	H419R	probably benign	Het
Gm9008	C	T	6: 76,496,809	V275I	probably benign	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
H2-M10.3	C	T	17: 36,367,830		probably null	Het
Hemgn	T	C	4: 46,396,477	E253G	probably damaging	Het
Itsn1	G	A	16: 91,899,649	V47M	probably damaging	Het
Kif5b	A	G	18: 6,208,257	V947A	probably benign	Het
Kif9	A	G	9: 110,489,867	H133R	probably benign	Het
Lce1l	T	C	3: 92,850,474	T26A	unknown	Het
Macf1	T	C	4: 123,493,988	E1172G	probably damaging	Het
Nkx3-2	C	T	5: 41,763,938	V3M	probably damaging	Het
Nr2e1	G	A	10: 42,578,191	T49I	probably benign	Het
Oc90	A	G	15: 65,892,393	L138P	probably damaging	Het
Olfr834	T	G	9: 18,987,982		probably null	Het
Olfr954	C	T	9: 39,462,231	R264*	probably null	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Paqr3	T	A	5: 97,103,361	N168I	possibly damaging	Het
Pcdhac1	T	A	18: 37,091,379	I415N	probably damaging	Het
Pdik1l	T	C	4: 134,278,896	N75S	probably damaging	Het
Pik3r4	A	G	9: 105,672,725	H1005R	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Prkch	A	G	12: 73,702,838	T402A	possibly damaging	Het
Ptger4	C	A	15: 5,242,379	R253L	probably damaging	Het
Rabac1	A	T	7: 24,970,160	Y173*	probably null	Het
Rapsn	G	A	2: 91,043,212	V288M	possibly damaging	Het
Sec31a	A	G	5: 100,365,958	S993P	probably damaging	Het
Serpina9	T	A	12: 104,001,294	M281L	probably benign	Het
Serpine1	G	A	5: 137,069,468	A117V	probably damaging	Het
Sh3tc2	A	G	18: 61,987,693		probably null	Het
Sipa1l2	T	C	8: 125,492,226	D124G	probably benign	Het
Slc6a12	T	A	6: 121,353,530		probably null	Het
Stk11	A	G	10: 80,116,601		probably benign	Het
Tcaf3	A	G	6: 42,589,996	Y720H	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmprss11a	C	T	5: 86,420,196	R224K	probably damaging	Het
Tmprss15	C	T	16: 78,957,356	S988N	probably benign	Het
Txn2	A	T	15: 77,915,443		probably null	Het
Ugt1a10	T	A	1: 88,056,197	V239E	probably damaging	Het
Vmn2r102	A	G	17: 19,681,213	Y534C	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69357062	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69346629	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69357383	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69349871	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69359965	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69357731	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69353211	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69359980	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69348742	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69358234	unclassified	probably benign
IGL01635:Chd3	APN	11	69361250	splice site	probably benign
IGL01942:Chd3	APN	11	69350105	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69357493	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69360675	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69361060	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69359829	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69352094	unclassified	probably benign
IGL02415:Chd3	APN	11	69348913	splice site	probably benign
IGL02648:Chd3	APN	11	69352150	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69361048	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69354404	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69361196	nonsense	probably null
IGL03168:Chd3	APN	11	69348915	splice site	probably benign
IGL03327:Chd3	APN	11	69350186	missense	probably damaging	1.00
burg	UTSW	11	69356554	missense	probably damaging	1.00
Fortress	UTSW	11	69364050	nonsense	probably null
Redoubt	UTSW	11	69353901	unclassified	probably benign
schloss	UTSW	11	69362060	nonsense	probably null
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69359913	unclassified	probably benign
R0129:Chd3	UTSW	11	69348501	nonsense	probably null
R0130:Chd3	UTSW	11	69359830	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69357018	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69356333	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69357541	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69354105	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69361669	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69345487	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69347195	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69357574	splice site	probably null
R1484:Chd3	UTSW	11	69359899	missense	probably benign	0.17
R1741:Chd3	UTSW	11	69355654	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69364697	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69353901	unclassified	probably benign
R1833:Chd3	UTSW	11	69354123	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69349052	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69349051	missense	probably benign
R2147:Chd3	UTSW	11	69349028	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69360645	missense	probably damaging	1.00
R2877:Chd3	UTSW	11	69361172	nonsense	probably null
R2879:Chd3	UTSW	11	69364098	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69360616	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69362147	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69364050	nonsense	probably null
R3845:Chd3	UTSW	11	69346759	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69359185	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69349001	missense	probably benign
R4115:Chd3	UTSW	11	69357517	missense	possibly damaging	0.95
R4612:Chd3	UTSW	11	69353209	nonsense	probably null
R4622:Chd3	UTSW	11	69349008	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69362187	unclassified	probably benign
R4635:Chd3	UTSW	11	69362187	unclassified	probably benign
R4859:Chd3	UTSW	11	69359896	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69354208	unclassified	probably benign
R5173:Chd3	UTSW	11	69369243	unclassified	probably benign
R5287:Chd3	UTSW	11	69349069	splice site	probably null
R5403:Chd3	UTSW	11	69349069	splice site	probably null
R5511:Chd3	UTSW	11	69361475	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69353351	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69361435	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69352118	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69349237	missense	probably benign
R6211:Chd3	UTSW	11	69352677	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69356554	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69345535	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69353778	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69361684	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69364031	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69352545	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69350112	nonsense	probably null
R6548:Chd3	UTSW	11	69362060	nonsense	probably null
R6582:Chd3	UTSW	11	69369156	unclassified	probably benign
R6721:Chd3	UTSW	11	69369219	unclassified	probably benign
R6776:Chd3	UTSW	11	69354470	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69369201	missense	unknown
R7136:Chd3	UTSW	11	69348438	missense	probably null	0.37
R7164:Chd3	UTSW	11	69362306	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69364095	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69369211	missense	unknown
R7238:Chd3	UTSW	11	69364047	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69345568	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69356270	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69357866	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69355633	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69353238	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69356625	missense	probably benign	0.13
R8150:Chd3	UTSW	11	69363684	missense	probably benign	0.02
R8161:Chd3	UTSW	11	69350885	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69360657	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69356258	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- AAGCTGTCCAACTTCATGCATC -3'
(R):5'- GCCAACTGTTCAGTCACTCAC -3'

Sequencing Primer
(F):5'- TCACACAAACAGCCTAGTAAGAGGG -3'
(R):5'- GTCACTCACTGTCTTTCCTCTCTGAG -3'

Posted On

2015-08-18