Incidental Mutation 'R4515:Chd3'
ID 332872
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Name chromodomain helicase DNA binding protein 3
Synonyms 2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69234099-69260232 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 69240703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1579 (R1579S)
Ref Sequence ENSEMBL: ENSMUSP00000104301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]
AlphaFold B1AR17
Predicted Effect probably benign
Transcript: ENSMUST00000092971
AA Change: R1579S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: R1579S

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108661
AA Change: R1579S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: R1579S

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122992
Predicted Effect unknown
Transcript: ENSMUST00000128981
AA Change: R1485S
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: R1485S

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146930
Predicted Effect probably benign
Transcript: ENSMUST00000151436
SMART Domains Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
Pfam:SNF2_N 1 142 9e-24 PFAM
SCOP:d1gkub2 162 197 1e-3 SMART
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Ckm A G 7: 19,154,209 (GRCm39) K319E probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Foxi1 A G 11: 34,157,972 (GRCm39) F18L probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Rnf26rt C T 6: 76,473,792 (GRCm39) V275I probably benign Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Slc6a12 T A 6: 121,330,489 (GRCm39) probably null Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss11a C T 5: 86,568,055 (GRCm39) R224K probably damaging Het
Tmprss15 C T 16: 78,754,244 (GRCm39) S988N probably benign Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Ugt1a10 T A 1: 87,983,919 (GRCm39) V239E probably damaging Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69,247,888 (GRCm39) missense probably damaging 0.96
IGL00551:Chd3 APN 11 69,237,455 (GRCm39) missense probably damaging 1.00
IGL00661:Chd3 APN 11 69,248,209 (GRCm39) missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69,240,697 (GRCm39) missense probably damaging 0.98
IGL01075:Chd3 APN 11 69,250,791 (GRCm39) missense probably damaging 1.00
IGL01309:Chd3 APN 11 69,248,557 (GRCm39) missense probably damaging 0.99
IGL01317:Chd3 APN 11 69,244,037 (GRCm39) missense probably damaging 1.00
IGL01374:Chd3 APN 11 69,250,806 (GRCm39) missense probably damaging 0.99
IGL01444:Chd3 APN 11 69,239,568 (GRCm39) missense probably benign 0.28
IGL01617:Chd3 APN 11 69,249,060 (GRCm39) unclassified probably benign
IGL01635:Chd3 APN 11 69,252,076 (GRCm39) splice site probably benign
IGL01942:Chd3 APN 11 69,240,931 (GRCm39) critical splice donor site probably null
IGL01962:Chd3 APN 11 69,248,319 (GRCm39) missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69,251,501 (GRCm39) missense probably damaging 0.99
IGL02022:Chd3 APN 11 69,251,886 (GRCm39) missense probably damaging 1.00
IGL02098:Chd3 APN 11 69,250,655 (GRCm39) missense probably damaging 1.00
IGL02218:Chd3 APN 11 69,242,920 (GRCm39) unclassified probably benign
IGL02415:Chd3 APN 11 69,239,739 (GRCm39) splice site probably benign
IGL02648:Chd3 APN 11 69,242,976 (GRCm39) missense probably damaging 1.00
IGL02951:Chd3 APN 11 69,251,874 (GRCm39) critical splice donor site probably null
IGL03030:Chd3 APN 11 69,245,230 (GRCm39) missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69,252,022 (GRCm39) nonsense probably null
IGL03168:Chd3 APN 11 69,239,741 (GRCm39) splice site probably benign
IGL03327:Chd3 APN 11 69,241,012 (GRCm39) missense probably damaging 1.00
burg UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
castello UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
feste UTSW 11 69,245,252 (GRCm39) nonsense probably null
Fortress UTSW 11 69,254,876 (GRCm39) nonsense probably null
moat UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
Redoubt UTSW 11 69,244,727 (GRCm39) unclassified probably benign
schloss UTSW 11 69,252,886 (GRCm39) nonsense probably null
siege UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0056:Chd3 UTSW 11 69,250,739 (GRCm39) unclassified probably benign
R0129:Chd3 UTSW 11 69,239,327 (GRCm39) nonsense probably null
R0130:Chd3 UTSW 11 69,250,656 (GRCm39) missense probably damaging 1.00
R0309:Chd3 UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0330:Chd3 UTSW 11 69,247,159 (GRCm39) missense probably damaging 1.00
R0449:Chd3 UTSW 11 69,248,367 (GRCm39) missense probably damaging 0.98
R0502:Chd3 UTSW 11 69,244,931 (GRCm39) missense probably damaging 0.98
R0540:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0571:Chd3 UTSW 11 69,252,495 (GRCm39) critical splice donor site probably null
R0607:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0616:Chd3 UTSW 11 69,236,313 (GRCm39) missense probably damaging 0.96
R0630:Chd3 UTSW 11 69,238,021 (GRCm39) missense probably damaging 1.00
R1436:Chd3 UTSW 11 69,248,400 (GRCm39) splice site probably null
R1484:Chd3 UTSW 11 69,250,725 (GRCm39) missense probably benign 0.17
R1741:Chd3 UTSW 11 69,246,480 (GRCm39) missense probably damaging 1.00
R1748:Chd3 UTSW 11 69,255,523 (GRCm39) missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69,244,727 (GRCm39) unclassified probably benign
R1833:Chd3 UTSW 11 69,244,949 (GRCm39) missense probably damaging 1.00
R2012:Chd3 UTSW 11 69,239,878 (GRCm39) missense probably benign 0.01
R2101:Chd3 UTSW 11 69,239,877 (GRCm39) missense probably benign
R2147:Chd3 UTSW 11 69,239,854 (GRCm39) missense probably benign 0.00
R2513:Chd3 UTSW 11 69,251,471 (GRCm39) missense probably damaging 1.00
R2877:Chd3 UTSW 11 69,251,998 (GRCm39) nonsense probably null
R2879:Chd3 UTSW 11 69,254,924 (GRCm39) missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2881:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2973:Chd3 UTSW 11 69,251,442 (GRCm39) missense probably damaging 1.00
R3611:Chd3 UTSW 11 69,252,973 (GRCm39) missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69,254,876 (GRCm39) nonsense probably null
R3845:Chd3 UTSW 11 69,237,585 (GRCm39) missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
R4007:Chd3 UTSW 11 69,239,827 (GRCm39) missense probably benign
R4115:Chd3 UTSW 11 69,248,343 (GRCm39) missense possibly damaging 0.95
R4612:Chd3 UTSW 11 69,244,035 (GRCm39) nonsense probably null
R4622:Chd3 UTSW 11 69,239,834 (GRCm39) missense probably damaging 0.98
R4634:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4635:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4859:Chd3 UTSW 11 69,250,722 (GRCm39) missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69,245,034 (GRCm39) unclassified probably benign
R5173:Chd3 UTSW 11 69,260,069 (GRCm39) unclassified probably benign
R5287:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5403:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5511:Chd3 UTSW 11 69,252,301 (GRCm39) missense probably damaging 1.00
R5666:Chd3 UTSW 11 69,244,177 (GRCm39) missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69,252,261 (GRCm39) missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69,242,944 (GRCm39) missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69,240,063 (GRCm39) missense probably benign
R6211:Chd3 UTSW 11 69,243,503 (GRCm39) missense probably damaging 1.00
R6215:Chd3 UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
R6217:Chd3 UTSW 11 69,236,361 (GRCm39) missense probably damaging 1.00
R6302:Chd3 UTSW 11 69,244,604 (GRCm39) missense probably damaging 0.98
R6329:Chd3 UTSW 11 69,252,510 (GRCm39) missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69,254,857 (GRCm39) missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69,243,371 (GRCm39) critical splice donor site probably null
R6453:Chd3 UTSW 11 69,240,938 (GRCm39) nonsense probably null
R6548:Chd3 UTSW 11 69,252,886 (GRCm39) nonsense probably null
R6582:Chd3 UTSW 11 69,259,982 (GRCm39) unclassified probably benign
R6721:Chd3 UTSW 11 69,260,045 (GRCm39) unclassified probably benign
R6776:Chd3 UTSW 11 69,245,296 (GRCm39) missense probably damaging 1.00
R6900:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69,260,027 (GRCm39) missense unknown
R7136:Chd3 UTSW 11 69,239,264 (GRCm39) missense probably null 0.37
R7164:Chd3 UTSW 11 69,253,132 (GRCm39) missense probably damaging 1.00
R7200:Chd3 UTSW 11 69,254,921 (GRCm39) missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69,260,037 (GRCm39) missense unknown
R7238:Chd3 UTSW 11 69,254,873 (GRCm39) missense probably benign 0.31
R7316:Chd3 UTSW 11 69,236,394 (GRCm39) missense probably damaging 0.99
R7560:Chd3 UTSW 11 69,247,096 (GRCm39) missense probably damaging 1.00
R7684:Chd3 UTSW 11 69,248,692 (GRCm39) missense possibly damaging 0.83
R7748:Chd3 UTSW 11 69,246,459 (GRCm39) missense probably benign 0.00
R7820:Chd3 UTSW 11 69,244,064 (GRCm39) missense probably damaging 1.00
R7885:Chd3 UTSW 11 69,247,451 (GRCm39) missense probably benign 0.13
R8150:Chd3 UTSW 11 69,254,510 (GRCm39) missense probably benign 0.02
R8161:Chd3 UTSW 11 69,241,711 (GRCm39) missense probably damaging 1.00
R8271:Chd3 UTSW 11 69,251,483 (GRCm39) missense probably damaging 1.00
R8334:Chd3 UTSW 11 69,241,622 (GRCm39) missense probably damaging 1.00
R8423:Chd3 UTSW 11 69,245,252 (GRCm39) nonsense probably null
R8690:Chd3 UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
R8828:Chd3 UTSW 11 69,247,097 (GRCm39) missense probably damaging 1.00
R8857:Chd3 UTSW 11 69,253,146 (GRCm39) missense probably benign 0.22
R9124:Chd3 UTSW 11 69,260,162 (GRCm39) missense unknown
R9170:Chd3 UTSW 11 69,241,648 (GRCm39) missense possibly damaging 0.64
R9213:Chd3 UTSW 11 69,255,628 (GRCm39) missense possibly damaging 0.53
R9285:Chd3 UTSW 11 69,249,954 (GRCm39) missense possibly damaging 0.64
R9293:Chd3 UTSW 11 69,244,027 (GRCm39) missense possibly damaging 0.94
R9368:Chd3 UTSW 11 69,251,200 (GRCm39) missense probably damaging 1.00
R9521:Chd3 UTSW 11 69,249,133 (GRCm39) missense probably benign 0.01
R9544:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
R9554:Chd3 UTSW 11 69,251,015 (GRCm39) missense probably damaging 1.00
R9588:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
X0022:Chd3 UTSW 11 69,247,084 (GRCm39) missense probably damaging 1.00
X0062:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
Z1186:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1186:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1187:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1187:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1188:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1188:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1189:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1189:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1190:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1190:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1191:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1191:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1192:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1192:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTGTCCAACTTCATGCATC -3'
(R):5'- GCCAACTGTTCAGTCACTCAC -3'

Sequencing Primer
(F):5'- TCACACAAACAGCCTAGTAAGAGGG -3'
(R):5'- GTCACTCACTGTCTTTCCTCTCTGAG -3'
Posted On 2015-08-18