Incidental Mutation 'R4515:Glod4'
ID332874
Institutional Source Beutler Lab
Gene Symbol Glod4
Ensembl Gene ENSMUSG00000017286
Gene Nameglyoxalase domain containing 4
Synonyms1700082G03Rik, 2700085E05Rik
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76120987-76243725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76243571 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 25 (D25V)
Ref Sequence ENSEMBL: ENSMUSP00000132496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017430] [ENSMUST00000040577] [ENSMUST00000168055] [ENSMUST00000169701] [ENSMUST00000170017] [ENSMUST00000170590] [ENSMUST00000170710]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017430
AA Change: D25V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017430
Gene: ENSMUSG00000017286
AA Change: D25V

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040577
SMART Domains Protein: ENSMUSP00000042882
Gene: ENSMUSG00000038046

DomainStartEndE-ValueType
SpoU_sub_bind 124 195 1.99e-5 SMART
Pfam:SpoU_methylase 209 398 2.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125463
Predicted Effect probably benign
Transcript: ENSMUST00000164022
SMART Domains Protein: ENSMUSP00000126699
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 2 212 1e-143 PDB
SCOP:d1mpya1 119 198 4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167883
Predicted Effect probably benign
Transcript: ENSMUST00000168055
SMART Domains Protein: ENSMUSP00000130675
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 2 98 3e-61 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect possibly damaging
Transcript: ENSMUST00000169701
AA Change: D25V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286
AA Change: D25V

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170017
AA Change: D25V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132496
Gene: ENSMUSG00000017286
AA Change: D25V

DomainStartEndE-ValueType
SCOP:d1qipa_ 1 40 3e-5 SMART
PDB:3ZI1|A 1 47 4e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000170590
AA Change: D25V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129009
Gene: ENSMUSG00000017286
AA Change: D25V

DomainStartEndE-ValueType
PDB:3ZI1|A 1 47 2e-23 PDB
SCOP:d1mpya2 1 66 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170710
SMART Domains Protein: ENSMUSP00000131788
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 124 237 6.1e-9 PFAM
Meta Mutation Damage Score 0.5838 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Glod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Glod4 APN 11 76233278 missense probably benign 0.08
IGL01099:Glod4 APN 11 76239550 nonsense probably null
IGL01761:Glod4 APN 11 76243602 missense probably benign 0.00
FR4548:Glod4 UTSW 11 76243310 start gained probably benign
R1354:Glod4 UTSW 11 76237828 splice site probably null
R1386:Glod4 UTSW 11 76222003 nonsense probably null
R1791:Glod4 UTSW 11 76237708 missense probably damaging 1.00
R2281:Glod4 UTSW 11 76237809 missense possibly damaging 0.74
R2484:Glod4 UTSW 11 76239518 missense probably damaging 1.00
R4517:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R4519:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R5945:Glod4 UTSW 11 76234471 missense probably damaging 1.00
R6471:Glod4 UTSW 11 76233918 missense probably damaging 1.00
R6488:Glod4 UTSW 11 76237785 missense probably damaging 0.96
R6976:Glod4 UTSW 11 76243580 missense probably damaging 1.00
R8263:Glod4 UTSW 11 76234492 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTTCAAAGGCTTCCCAACCCG -3'
(R):5'- GAGGGAGACAACACTCTCAC -3'

Sequencing Primer
(F):5'- GCTTCCCAACCCGAAAGAGG -3'
(R):5'- CAGCAATGATCCCAGGGAGC -3'
Posted On2015-08-18