Incidental Mutation 'R4515:Prkch'
ID332876
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Nameprotein kinase C, eta
SynonymsPkch
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73584796-73778185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73702838 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 402 (T402A)
Ref Sequence ENSEMBL: ENSMUSP00000021527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021527
AA Change: T402A

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: T402A

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119092
SMART Domains Protein: ENSMUSP00000112499
Gene: ENSMUSG00000021108

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 597 6.67e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221153
Meta Mutation Damage Score 0.2981 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8294:Prkch UTSW 12 73759710 missense probably damaging 1.00
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R8312:Prkch UTSW 12 73760584 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACAAGCATGCTGTGTATGTGTG -3'
(R):5'- CTTTCTGTGAGACAGGAGGC -3'

Sequencing Primer
(F):5'- GCTGTTGGCGTACATGTATG -3'
(R):5'- CTGTGAGGTGGGGAGCAC -3'
Posted On2015-08-18