Incidental Mutation 'R4515:Oc90'
ID332880
Institutional Source Beutler Lab
Gene Symbol Oc90
Ensembl Gene ENSMUSG00000015001
Gene Nameotoconin 90
SynonymsPla2ll, PLA2L, Ocn-95
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4515 (G1)
Quality Score218
Status Validated
Chromosome15
Chromosomal Location65876053-65912397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65892393 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 138 (L138P)
Ref Sequence ENSEMBL: ENSMUSP00000062865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060522] [ENSMUST00000079776]
Predicted Effect probably damaging
Transcript: ENSMUST00000060522
AA Change: L138P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062865
Gene: ENSMUSG00000015001
AA Change: L138P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 314 429 3.5e-15 SMART
low complexity region 446 458 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079776
AA Change: L138P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078709
Gene: ENSMUSG00000015001
AA Change: L138P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 282 397 3.5e-15 SMART
low complexity region 414 426 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135442
AA Change: L15P
SMART Domains Protein: ENSMUSP00000114254
Gene: ENSMUSG00000015001
AA Change: L15P

DomainStartEndE-ValueType
internal_repeat_1 2 67 2.77e-7 PROSPERO
PA2c 159 274 3.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147776
SMART Domains Protein: ENSMUSP00000118937
Gene: ENSMUSG00000015001

DomainStartEndE-ValueType
PA2c 122 220 8.1e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156996
AA Change: L121P
SMART Domains Protein: ENSMUSP00000121227
Gene: ENSMUSG00000015001
AA Change: L121P

DomainStartEndE-ValueType
PA2c 58 174 1.75e-15 SMART
PA2c 283 398 3.5e-15 SMART
low complexity region 415 427 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Meta Mutation Damage Score 0.2560 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced, enlarged, and loose otoliths, and thin cupula, saccule, utricle and tectorial membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Itsn1 G A 16: 91,899,649 V47M probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Oc90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Oc90 APN 15 65889591 missense probably benign 0.00
IGL01746:Oc90 APN 15 65889401 splice site probably benign
IGL02101:Oc90 APN 15 65897789 missense probably damaging 1.00
IGL02175:Oc90 APN 15 65883825 missense possibly damaging 0.96
IGL02691:Oc90 APN 15 65882561 missense probably damaging 1.00
IGL02947:Oc90 APN 15 65888134 missense probably benign 0.16
R0010:Oc90 UTSW 15 65876548 missense probably damaging 1.00
R0325:Oc90 UTSW 15 65897665 critical splice donor site probably null
R1466:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1466:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1496:Oc90 UTSW 15 65876521 missense probably damaging 1.00
R1584:Oc90 UTSW 15 65897720 missense probably damaging 1.00
R1837:Oc90 UTSW 15 65889680 missense probably damaging 1.00
R3552:Oc90 UTSW 15 65878801 missense possibly damaging 0.81
R4018:Oc90 UTSW 15 65887608 missense probably benign 0.00
R4700:Oc90 UTSW 15 65881505 missense possibly damaging 0.91
R4828:Oc90 UTSW 15 65881559 missense probably damaging 1.00
R5135:Oc90 UTSW 15 65883830 missense probably benign 0.00
R5320:Oc90 UTSW 15 65882608 missense probably benign 0.06
R5727:Oc90 UTSW 15 65881539 missense possibly damaging 0.61
R5837:Oc90 UTSW 15 65876446 missense probably benign 0.03
R6086:Oc90 UTSW 15 65889711 missense probably damaging 1.00
R6807:Oc90 UTSW 15 65889614 missense probably damaging 1.00
Z1177:Oc90 UTSW 15 65876347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCAATCATTTCTCAAGCTGGC -3'
(R):5'- GTGCCAGATACCATCCAGAC -3'

Sequencing Primer
(F):5'- CATAACATGTCTTTGAAGGCGAC -3'
(R):5'- GACATCAGCATGATCTCAGCGTG -3'
Posted On2015-08-18