Incidental Mutation 'R4515:Tmprss15'
ID 332882
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Name transmembrane protease, serine 15
Synonyms Prss7, enterokinase, enteropeptidase, A130097D21Rik
MMRRC Submission 041589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4515 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 78749896-78887985 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78754244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 988 (S988N)
Ref Sequence ENSEMBL: ENSMUSP00000052034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
AlphaFold P97435
Predicted Effect probably benign
Transcript: ENSMUST00000023566
AA Change: S1003N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: S1003N

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060402
AA Change: S988N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: S988N

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,646,006 (GRCm39) K630N probably damaging Het
Acss2 C A 2: 155,398,283 (GRCm39) L335I probably benign Het
Alg6 A T 4: 99,641,023 (GRCm39) probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Bsn G T 9: 107,981,277 (GRCm39) probably null Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cdhr4 G A 9: 107,870,150 (GRCm39) E52K probably benign Het
Ces1a T A 8: 93,747,532 (GRCm39) N500Y probably damaging Het
Chd3 G T 11: 69,240,703 (GRCm39) R1579S probably benign Het
Chrnb3 T C 8: 27,875,118 (GRCm39) L39P probably damaging Het
Ckm A G 7: 19,154,209 (GRCm39) K319E probably damaging Het
Cnot6 C T 11: 49,593,363 (GRCm39) probably null Het
Copg1 A G 6: 87,884,528 (GRCm39) probably benign Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnah2 A G 11: 69,356,457 (GRCm39) S2135P possibly damaging Het
Dsg2 C A 18: 20,734,444 (GRCm39) D807E probably benign Het
Foxi1 A G 11: 34,157,972 (GRCm39) F18L probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Hemgn T C 4: 46,396,477 (GRCm39) E253G probably damaging Het
Itsn1 G A 16: 91,696,537 (GRCm39) V47M probably damaging Het
Kif5b A G 18: 6,208,257 (GRCm39) V947A probably benign Het
Kif9 A G 9: 110,318,935 (GRCm39) H133R probably benign Het
Lce1l T C 3: 92,757,781 (GRCm39) T26A unknown Het
Macf1 T C 4: 123,387,781 (GRCm39) E1172G probably damaging Het
Nkx3-2 C T 5: 41,921,281 (GRCm39) V3M probably damaging Het
Nr2e1 G A 10: 42,454,187 (GRCm39) T49I probably benign Het
Oc90 A G 15: 65,764,242 (GRCm39) L138P probably damaging Het
Or7g12 T G 9: 18,899,278 (GRCm39) probably null Het
Or8g34 C T 9: 39,373,527 (GRCm39) R264* probably null Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Paqr3 T A 5: 97,251,220 (GRCm39) N168I possibly damaging Het
Pcdhac1 T A 18: 37,224,432 (GRCm39) I415N probably damaging Het
Pdik1l T C 4: 134,006,207 (GRCm39) N75S probably damaging Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prkch A G 12: 73,749,612 (GRCm39) T402A possibly damaging Het
Ptger4 C A 15: 5,271,860 (GRCm39) R253L probably damaging Het
Rabac1 A T 7: 24,669,585 (GRCm39) Y173* probably null Het
Rapsn G A 2: 90,873,557 (GRCm39) V288M possibly damaging Het
Rnf26rt C T 6: 76,473,792 (GRCm39) V275I probably benign Het
Sec31a A G 5: 100,513,817 (GRCm39) S993P probably damaging Het
Septin4 A G 11: 87,458,883 (GRCm39) H419R probably benign Het
Serpina9 T A 12: 103,967,553 (GRCm39) M281L probably benign Het
Serpine1 G A 5: 137,098,322 (GRCm39) A117V probably damaging Het
Sh3tc2 A G 18: 62,120,764 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Slc6a12 T A 6: 121,330,489 (GRCm39) probably null Het
Stk11 A G 10: 79,952,435 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,566,930 (GRCm39) Y720H probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Tmprss11a C T 5: 86,568,055 (GRCm39) R224K probably damaging Het
Txn2 A T 15: 77,799,643 (GRCm39) probably null Het
Ugt1a10 T A 1: 87,983,919 (GRCm39) V239E probably damaging Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Vmn2r78 A T 7: 86,603,466 (GRCm39) D548V probably damaging Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78,782,882 (GRCm39) missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 78,818,301 (GRCm39) missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 78,868,149 (GRCm39) missense probably benign
IGL01896:Tmprss15 APN 16 78,887,678 (GRCm39) missense probably benign 0.22
IGL02052:Tmprss15 APN 16 78,884,394 (GRCm39) missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 78,832,056 (GRCm39) missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78,784,629 (GRCm39) missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78,782,790 (GRCm39) missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 78,798,682 (GRCm39) missense possibly damaging 0.72
beached UTSW 16 78,821,736 (GRCm39) missense possibly damaging 0.62
Cellulite UTSW 16 78,754,259 (GRCm39) missense probably damaging 1.00
lolling UTSW 16 78,800,298 (GRCm39) missense probably benign 0.26
miniature UTSW 16 78,854,497 (GRCm39) critical splice donor site probably null
PIT1430001:Tmprss15 UTSW 16 78,821,640 (GRCm39) critical splice donor site probably null
R0106:Tmprss15 UTSW 16 78,800,277 (GRCm39) missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 78,800,277 (GRCm39) missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 78,831,222 (GRCm39) missense probably benign 0.05
R0335:Tmprss15 UTSW 16 78,821,630 (GRCm39) splice site probably benign
R0514:Tmprss15 UTSW 16 78,765,155 (GRCm39) missense probably benign 0.05
R0552:Tmprss15 UTSW 16 78,821,637 (GRCm39) splice site probably null
R0675:Tmprss15 UTSW 16 78,782,838 (GRCm39) missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 78,821,736 (GRCm39) missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 78,818,342 (GRCm39) missense probably benign 0.03
R1446:Tmprss15 UTSW 16 78,875,846 (GRCm39) missense probably benign 0.01
R1572:Tmprss15 UTSW 16 78,887,717 (GRCm39) missense probably benign 0.00
R1708:Tmprss15 UTSW 16 78,850,958 (GRCm39) missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 78,868,306 (GRCm39) missense probably benign
R2403:Tmprss15 UTSW 16 78,854,578 (GRCm39) missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 78,832,121 (GRCm39) missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78,759,078 (GRCm39) missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78,759,078 (GRCm39) missense probably benign 0.45
R3425:Tmprss15 UTSW 16 78,800,321 (GRCm39) missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 78,851,030 (GRCm39) critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78,782,884 (GRCm39) missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 78,870,074 (GRCm39) missense probably benign 0.04
R4332:Tmprss15 UTSW 16 78,831,222 (GRCm39) missense probably benign 0.15
R4392:Tmprss15 UTSW 16 78,821,326 (GRCm39) missense probably damaging 1.00
R4619:Tmprss15 UTSW 16 78,818,358 (GRCm39) missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 78,818,358 (GRCm39) missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 78,851,012 (GRCm39) missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78,757,479 (GRCm39) missense probably benign
R5159:Tmprss15 UTSW 16 78,800,298 (GRCm39) missense probably benign 0.26
R5441:Tmprss15 UTSW 16 78,868,335 (GRCm39) critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 78,831,201 (GRCm39) missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 78,854,547 (GRCm39) missense probably benign 0.00
R6224:Tmprss15 UTSW 16 78,821,266 (GRCm39) missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78,769,113 (GRCm39) missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78,759,058 (GRCm39) missense probably benign 0.16
R6368:Tmprss15 UTSW 16 78,802,945 (GRCm39) splice site probably null
R6525:Tmprss15 UTSW 16 78,800,266 (GRCm39) missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 78,868,317 (GRCm39) missense probably benign
R6894:Tmprss15 UTSW 16 78,872,702 (GRCm39) nonsense probably null
R7018:Tmprss15 UTSW 16 78,821,741 (GRCm39) missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78,764,886 (GRCm39) missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78,758,907 (GRCm39) missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 78,868,164 (GRCm39) missense probably benign 0.01
R7558:Tmprss15 UTSW 16 78,800,302 (GRCm39) missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 78,800,308 (GRCm39) missense probably benign 0.11
R7792:Tmprss15 UTSW 16 78,800,275 (GRCm39) missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78,784,538 (GRCm39) missense probably benign 0.02
R7998:Tmprss15 UTSW 16 78,798,731 (GRCm39) missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 78,887,751 (GRCm39) missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78,757,473 (GRCm39) missense probably damaging 1.00
R8183:Tmprss15 UTSW 16 78,884,400 (GRCm39) missense probably benign 0.04
R8221:Tmprss15 UTSW 16 78,821,223 (GRCm39) missense probably damaging 0.99
R8294:Tmprss15 UTSW 16 78,868,176 (GRCm39) missense probably benign
R8537:Tmprss15 UTSW 16 78,884,403 (GRCm39) missense probably damaging 0.99
R8735:Tmprss15 UTSW 16 78,798,702 (GRCm39) missense possibly damaging 0.88
R8858:Tmprss15 UTSW 16 78,854,497 (GRCm39) critical splice donor site probably null
R8869:Tmprss15 UTSW 16 78,750,834 (GRCm39) nonsense probably null
R8884:Tmprss15 UTSW 16 78,821,657 (GRCm39) missense probably benign 0.00
R9014:Tmprss15 UTSW 16 78,872,691 (GRCm39) missense probably benign 0.04
R9075:Tmprss15 UTSW 16 78,754,259 (GRCm39) missense probably damaging 1.00
R9351:Tmprss15 UTSW 16 78,832,086 (GRCm39) missense probably damaging 1.00
R9393:Tmprss15 UTSW 16 78,754,211 (GRCm39) missense probably benign 0.01
R9747:Tmprss15 UTSW 16 78,884,400 (GRCm39) missense probably benign 0.04
R9767:Tmprss15 UTSW 16 78,875,977 (GRCm39) missense probably damaging 1.00
R9783:Tmprss15 UTSW 16 78,887,890 (GRCm39) start gained probably benign
RF005:Tmprss15 UTSW 16 78,750,689 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TGACAAGTGGCTCGCCTAAAG -3'
(R):5'- CTTGAAAGTGCAAGGTTGGTAG -3'

Sequencing Primer
(F):5'- GTCACTCATTCTCAACGTGAAAGGG -3'
(R):5'- CCACATAGTACTTGATAATGAGAGC -3'
Posted On 2015-08-18