Incidental Mutation 'R4515:Itsn1'
ID332883
Institutional Source Beutler Lab
Gene Symbol Itsn1
Ensembl Gene ENSMUSG00000022957
Gene Nameintersectin 1 (SH3 domain protein 1A)
SynonymsIntersectin-L, EHSH1, Eh domain, SH3 domain regulator of endocytosis 1, Ese1, Sh3p17
MMRRC Submission 041589-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4515 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91729281-91920597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91899649 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 47 (V47M)
Ref Sequence ENSEMBL: ENSMUSP00000115563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064797] [ENSMUST00000114002] [ENSMUST00000141625] [ENSMUST00000159295] [ENSMUST00000231735] [ENSMUST00000231852]
Predicted Effect unknown
Transcript: ENSMUST00000064797
AA Change: V1438M
SMART Domains Protein: ENSMUSP00000066361
Gene: ENSMUSG00000022957
AA Change: V1438M

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 803 1.62e-16 SMART
SH3 914 968 2.64e-16 SMART
SH3 1003 1057 1.82e-19 SMART
SH3 1075 1135 2.46e-16 SMART
SH3 1156 1211 7.97e-25 SMART
RhoGEF 1239 1420 1e-63 SMART
PH 1461 1571 6.07e-13 SMART
C2 1595 1692 1.58e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114002
AA Change: V1433M
SMART Domains Protein: ENSMUSP00000109635
Gene: ENSMUSG00000022957
AA Change: V1433M

DomainStartEndE-ValueType
EH 14 108 1.34e-43 SMART
EFh 57 85 2.14e-1 SMART
low complexity region 138 165 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
EH 214 309 2.55e-49 SMART
EFh 258 286 1.77e-2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 352 447 N/A INTRINSIC
coiled coil region 468 515 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
coiled coil region 561 661 N/A INTRINSIC
low complexity region 687 696 N/A INTRINSIC
SH3 741 798 1.05e-19 SMART
SH3 909 963 2.64e-16 SMART
SH3 998 1052 1.82e-19 SMART
SH3 1070 1130 2.46e-16 SMART
SH3 1151 1206 7.97e-25 SMART
RhoGEF 1234 1415 1e-63 SMART
PH 1456 1566 6.07e-13 SMART
C2 1590 1687 1.58e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125052
SMART Domains Protein: ENSMUSP00000115985
Gene: ENSMUSG00000022957

DomainStartEndE-ValueType
RhoGEF 6 185 1.19e-38 SMART
PH 172 282 6.07e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131739
AA Change: V47M
SMART Domains Protein: ENSMUSP00000114145
Gene: ENSMUSG00000022957
AA Change: V47M

DomainStartEndE-ValueType
SCOP:d1ki1b1 2 46 2e-11 SMART
Blast:PH 2 58 5e-32 BLAST
PDB:3QBV|D 2 59 8e-33 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000141625
AA Change: V47M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115563
Gene: ENSMUSG00000022957
AA Change: V47M

DomainStartEndE-ValueType
PH 17 109 2.02e0 SMART
Pfam:C2 134 173 7.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231735
Predicted Effect probably benign
Transcript: ENSMUST00000231852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232198
Meta Mutation Damage Score 0.1756 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic membrane-associated protein that indirectly coordinates endocytic membrane traffic with the actin assembly machinery. In addition, the encoded protein may regulate the formation of clathrin-coated vesicles and could be involved in synaptic vesicle recycling. This protein has been shown to interact with dynamin, CDC42, SNAP23, SNAP25, SPIN90, EPS15, EPN1, EPN2, and STN2. Multiple transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been characterized so far. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a gene trapped allele exhibit embryonic lethal. Mice homozygous for a null allele exhibit some postnatal lethality and impaired vesicle recycling in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G T 5: 138,647,744 K630N probably damaging Het
Acss2 C A 2: 155,556,363 L335I probably benign Het
Alg6 A T 4: 99,752,786 probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Bsn G T 9: 108,104,078 probably null Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cdhr4 G A 9: 107,992,951 E52K probably benign Het
Ces1a T A 8: 93,020,904 N500Y probably damaging Het
Chd3 G T 11: 69,349,877 R1579S probably benign Het
Chrnb3 T C 8: 27,385,090 L39P probably damaging Het
Ckm A G 7: 19,420,284 K319E probably damaging Het
Cnot6 C T 11: 49,702,536 probably null Het
Copg1 A G 6: 87,907,546 probably benign Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnah2 A G 11: 69,465,631 S2135P possibly damaging Het
Dsg2 C A 18: 20,601,387 D807E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxi1 A G 11: 34,207,972 F18L probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm11492 A G 11: 87,568,057 H419R probably benign Het
Gm9008 C T 6: 76,496,809 V275I probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Hemgn T C 4: 46,396,477 E253G probably damaging Het
Kif5b A G 18: 6,208,257 V947A probably benign Het
Kif9 A G 9: 110,489,867 H133R probably benign Het
Lce1l T C 3: 92,850,474 T26A unknown Het
Macf1 T C 4: 123,493,988 E1172G probably damaging Het
Nkx3-2 C T 5: 41,763,938 V3M probably damaging Het
Nr2e1 G A 10: 42,578,191 T49I probably benign Het
Oc90 A G 15: 65,892,393 L138P probably damaging Het
Olfr834 T G 9: 18,987,982 probably null Het
Olfr954 C T 9: 39,462,231 R264* probably null Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Paqr3 T A 5: 97,103,361 N168I possibly damaging Het
Pcdhac1 T A 18: 37,091,379 I415N probably damaging Het
Pdik1l T C 4: 134,278,896 N75S probably damaging Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prkch A G 12: 73,702,838 T402A possibly damaging Het
Ptger4 C A 15: 5,242,379 R253L probably damaging Het
Rabac1 A T 7: 24,970,160 Y173* probably null Het
Rapsn G A 2: 91,043,212 V288M possibly damaging Het
Sec31a A G 5: 100,365,958 S993P probably damaging Het
Serpina9 T A 12: 104,001,294 M281L probably benign Het
Serpine1 G A 5: 137,069,468 A117V probably damaging Het
Sh3tc2 A G 18: 61,987,693 probably null Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Slc6a12 T A 6: 121,353,530 probably null Het
Stk11 A G 10: 80,116,601 probably benign Het
Tcaf3 A G 6: 42,589,996 Y720H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmprss11a C T 5: 86,420,196 R224K probably damaging Het
Tmprss15 C T 16: 78,957,356 S988N probably benign Het
Txn2 A T 15: 77,915,443 probably null Het
Ugt1a10 T A 1: 88,056,197 V239E probably damaging Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Other mutations in Itsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Itsn1 APN 16 91806201 unclassified probably benign
IGL01799:Itsn1 APN 16 91848882 missense probably damaging 1.00
IGL02328:Itsn1 APN 16 91815407 missense probably damaging 1.00
IGL02333:Itsn1 APN 16 91820676 intron probably benign
IGL02503:Itsn1 APN 16 91889204 missense possibly damaging 0.62
IGL02628:Itsn1 APN 16 91899623 missense possibly damaging 0.79
IGL02666:Itsn1 APN 16 91820718 intron probably benign
IGL03007:Itsn1 APN 16 91784162 splice site probably benign
IGL03223:Itsn1 APN 16 91905306 missense probably benign 0.00
raphael UTSW 16 91820796 intron probably benign
weevil UTSW 16 91818552 intron probably benign
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0234:Itsn1 UTSW 16 91828280 nonsense probably null
R0255:Itsn1 UTSW 16 91806090 unclassified probably benign
R0432:Itsn1 UTSW 16 91815520 missense probably damaging 1.00
R0455:Itsn1 UTSW 16 91868148 intron probably benign
R0471:Itsn1 UTSW 16 91899589 missense probably damaging 1.00
R0558:Itsn1 UTSW 16 91899623 missense possibly damaging 0.79
R0563:Itsn1 UTSW 16 91820796 intron probably benign
R1657:Itsn1 UTSW 16 91909223 missense probably damaging 1.00
R1671:Itsn1 UTSW 16 91812150 missense probably damaging 1.00
R1742:Itsn1 UTSW 16 91816959 critical splice donor site probably null
R1859:Itsn1 UTSW 16 91889154 intron probably benign
R1898:Itsn1 UTSW 16 91899580 missense probably damaging 1.00
R2016:Itsn1 UTSW 16 91905501 critical splice donor site probably null
R2221:Itsn1 UTSW 16 91853768 intron probably benign
R2244:Itsn1 UTSW 16 91853771 missense probably null
R3160:Itsn1 UTSW 16 91853044 nonsense probably null
R3162:Itsn1 UTSW 16 91853044 nonsense probably null
R3814:Itsn1 UTSW 16 91852921 missense possibly damaging 0.96
R4162:Itsn1 UTSW 16 91852902 missense probably benign 0.00
R4254:Itsn1 UTSW 16 91818552 intron probably benign
R4319:Itsn1 UTSW 16 91818552 intron probably benign
R4321:Itsn1 UTSW 16 91818552 intron probably benign
R4323:Itsn1 UTSW 16 91818552 intron probably benign
R4326:Itsn1 UTSW 16 91853855 intron probably benign
R4584:Itsn1 UTSW 16 91820583 intron probably benign
R4600:Itsn1 UTSW 16 91899587 missense probably damaging 1.00
R4649:Itsn1 UTSW 16 91841588 missense probably damaging 1.00
R4834:Itsn1 UTSW 16 91906789 nonsense probably null
R4868:Itsn1 UTSW 16 91785317 missense probably damaging 0.98
R5036:Itsn1 UTSW 16 91782235 splice site probably benign
R5122:Itsn1 UTSW 16 91893844 intron probably benign
R5161:Itsn1 UTSW 16 91908838 missense possibly damaging 0.95
R5437:Itsn1 UTSW 16 91818591 intron probably benign
R5538:Itsn1 UTSW 16 91784102 missense probably damaging 1.00
R5683:Itsn1 UTSW 16 91905380 missense probably benign 0.00
R5697:Itsn1 UTSW 16 91801589 missense possibly damaging 0.56
R5749:Itsn1 UTSW 16 91906855 missense probably damaging 0.99
R6083:Itsn1 UTSW 16 91853011 missense probably benign 0.01
R6148:Itsn1 UTSW 16 91816852 missense probably damaging 1.00
R6291:Itsn1 UTSW 16 91868096 intron probably benign
R6524:Itsn1 UTSW 16 91911995 missense probably damaging 0.96
R7175:Itsn1 UTSW 16 91868050 missense unknown
R7261:Itsn1 UTSW 16 91905306 missense probably benign 0.00
R7320:Itsn1 UTSW 16 91839699 missense unknown
R7366:Itsn1 UTSW 16 91908450 missense unknown
R7462:Itsn1 UTSW 16 91853185 missense possibly damaging 0.53
R7665:Itsn1 UTSW 16 91841603 missense unknown
R7720:Itsn1 UTSW 16 91868083 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAACACTGTGGTTTCCATGAC -3'
(R):5'- CTGCTCATCAGTTGTATTAACGAG -3'

Sequencing Primer
(F):5'- CACTGTGGTTTCCATGACAACGG -3'
(R):5'- TCATCAGTTGTATTAACGAGCGGGAG -3'
Posted On2015-08-18