Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Treml2'

33289

Institutional Source

Beutler Lab

Gene Symbol

Treml2

Ensembl Gene

ENSMUSG00000071068

Gene Name

triggering receptor expressed on myeloid cells-like 2

Synonyms

LOC328833

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R0105 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

48300038-48312534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 48302828 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 96 (T96I)

Ref Sequence

ENSEMBL: ENSMUSP00000128215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170941]

AlphaFold

Q2LA85

Predicted Effect

probably damaging
Transcript: ENSMUST00000170941
AA Change: T96I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128215
Gene: ENSMUSG00000071068
AA Change: T96I

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	31	129	3.13e-5	SMART
low complexity region	181	199	N/A	INTRINSIC
transmembrane domain	268	290	N/A	INTRINSIC

Meta Mutation Damage Score

0.8266

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TREML2 is located in a gene cluster on chromosome 6 with the single Ig variable (IgV) domain activating receptors TREM1 (MIM 605085) and TREM2 (MIM 605086), but it has distinct structural and functional properties (Allcock et al., 2003 [PubMed 12645956]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Treml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01767:Treml2	APN	17	48302810	missense	probably benign
IGL02797:Treml2	APN	17	48302711	missense	possibly damaging	0.73
Cottonwood	UTSW	17	48302747	missense	possibly damaging	0.89
poplar	UTSW	17	48302734	nonsense	probably null
R0105:Treml2	UTSW	17	48302828	missense	probably damaging	0.99
R0670:Treml2	UTSW	17	48307836	splice site	probably null
R1538:Treml2	UTSW	17	48302758	missense	possibly damaging	0.77
R1796:Treml2	UTSW	17	48309502	makesense	probably null
R4396:Treml2	UTSW	17	48308114	missense	probably benign	0.00
R4679:Treml2	UTSW	17	48308175	missense	probably benign	0.36
R4687:Treml2	UTSW	17	48309397	splice site	probably null
R4801:Treml2	UTSW	17	48309159	missense	probably benign	0.18
R4802:Treml2	UTSW	17	48309159	missense	probably benign	0.18
R5314:Treml2	UTSW	17	48300573	missense	probably damaging	0.99
R6791:Treml2	UTSW	17	48309219	missense	probably benign	0.24
R6818:Treml2	UTSW	17	48302897	missense	probably damaging	1.00
R6958:Treml2	UTSW	17	48308152	missense	probably damaging	1.00
R7250:Treml2	UTSW	17	48309127	missense	probably benign	0.05
R7535:Treml2	UTSW	17	48302819	missense	probably damaging	1.00
R7850:Treml2	UTSW	17	48308140	missense	probably benign	0.01
R8049:Treml2	UTSW	17	48302734	nonsense	probably null
R8998:Treml2	UTSW	17	48302747	missense	possibly damaging	0.89
R9012:Treml2	UTSW	17	48308062	missense	possibly damaging	0.86
R9208:Treml2	UTSW	17	48307894	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTCAGAAAAGTCCTGTCTCCCC -3'
(R):5'- AGAACCATTGTTCCATGATCCCGC -3'

Sequencing Primer
(F):5'- GGTCACTCCAATGAGAACCTG -3'
(R):5'- CATGATCCCGCCCGTCC -3'

Posted On

2013-05-09