Mutagenetix > Incidental Mutations

Incidental Mutation 'R4516:Rab3gap2'

332894

Institutional Source

Beutler Lab

Gene Symbol

Rab3gap2

Ensembl Gene

ENSMUSG00000039318

Gene Name

RAB3 GTPase activating protein subunit 2

Synonyms

1110059F07Rik

MMRRC Submission

041760-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

185204117-185286759 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 185267068 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 991 (V991I)

Ref Sequence

ENSEMBL: ENSMUSP00000066325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]

Predicted Effect

probably benign
Transcript: ENSMUST00000069652
AA Change: V991I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: V991I

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-167	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	767	1366	3.2e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193482

Predicted Effect

probably benign
Transcript: ENSMUST00000194740

SMART Domains

Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
Pfam:RAB3GAP2_N	73	497	1.3e-157	PFAM
low complexity region	667	686	N/A	INTRINSIC
Pfam:RAB3GAP2_C	766	1346	2.5e-233	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195042

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.6%
20x: 92.9%

Validation Efficiency

86% (51/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,517,200		probably benign	Het
4930452B06Rik	A	T	14: 8,536,609	D199E	probably damaging	Het
4932438A13Rik	T	C	3: 36,895,311	S369P	possibly damaging	Het
Bean1	T	C	8: 104,215,154	S211P	probably damaging	Het
Camta1	A	G	4: 151,144,720	S552P	possibly damaging	Het
Cdh11	T	C	8: 102,673,962	T125A	possibly damaging	Het
Cdk5rap2	A	T	4: 70,276,715		probably null	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Cfap44	T	A	16: 44,473,864	Y224*	probably null	Het
Cfap46	G	A	7: 139,660,082		probably benign	Het
Cntrl	G	A	2: 35,127,981	V468I	probably benign	Het
Col6a6	C	T	9: 105,698,949	V2071I	possibly damaging	Het
Coq7	A	T	7: 118,509,907	L306Q	unknown	Het
D7Ertd443e	C	G	7: 134,293,328	Q591H	probably damaging	Het
Dchs1	C	T	7: 105,754,852	V2828M	probably damaging	Het
Dzank1	T	A	2: 144,510,122		probably benign	Het
Elmo1	C	T	13: 20,282,914	T235I	probably benign	Het
Elp3	A	T	14: 65,547,877	F492I	possibly damaging	Het
Espl1	A	G	15: 102,323,236	S90G	probably benign	Het
Fbxl20	T	C	11: 98,095,235		probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gm16286	G	A	18: 80,211,576	M28I	probably benign	Het
Got1	T	C	19: 43,504,841	Y243C	probably damaging	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Kif21a	A	T	15: 90,971,142	M673K	probably benign	Het
Lama3	T	A	18: 12,495,358	D1502E	probably damaging	Het
Limk1	A	G	5: 134,676,786		probably benign	Het
Myo5b	A	G	18: 74,625,674	Y242C	probably damaging	Het
Ncbp1	T	C	4: 46,157,824	V354A	probably damaging	Het
Ncoa2	T	C	1: 13,146,906	D1380G	probably damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Oas1d	A	T	5: 120,919,170	T280S	probably damaging	Het
Olfr1229	T	A	2: 89,282,843	M118L	probably benign	Het
Olfr389	C	T	11: 73,777,040	G96S	probably benign	Het
Pax7	T	G	4: 139,780,793	D307A	probably benign	Het
Pdxdc1	G	A	16: 13,838,346	Q621*	probably null	Het
Rab29	A	T	1: 131,867,731	Y27F	possibly damaging	Het
Ric1	A	G	19: 29,570,765	T278A	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc47a1	T	C	11: 61,344,513	H498R	probably benign	Het
Tas2r116	T	C	6: 132,856,150	L238P	probably damaging	Het
Tigd5	A	T	15: 75,910,515	R252*	probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Tmem106b	C	T	6: 13,075,099	T95I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn1r174	A	G	7: 23,754,343	I145V	probably benign	Het
Vps26a	T	C	10: 62,468,345	M116V	probably damaging	Het

Other mutations in Rab3gap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Rab3gap2	APN	1	185238870	missense	probably damaging	1.00
IGL01620:Rab3gap2	APN	1	185204326	missense	probably benign
IGL01977:Rab3gap2	APN	1	185267023	nonsense	probably null
IGL02183:Rab3gap2	APN	1	185271468	nonsense	probably null
IGL02229:Rab3gap2	APN	1	185259383	missense	possibly damaging	0.71
IGL02231:Rab3gap2	APN	1	185266898	splice site	probably benign
IGL02506:Rab3gap2	APN	1	185252024	splice site	probably benign
IGL02618:Rab3gap2	APN	1	185251741	missense	possibly damaging	0.79
IGL02643:Rab3gap2	APN	1	185267000	missense	possibly damaging	0.69
IGL03239:Rab3gap2	APN	1	185249894	missense	probably damaging	1.00
PIT4498001:Rab3gap2	UTSW	1	185281685	missense	probably damaging	1.00
R0173:Rab3gap2	UTSW	1	185249907	missense	possibly damaging	0.51
R0372:Rab3gap2	UTSW	1	185262694	missense	possibly damaging	0.93
R0492:Rab3gap2	UTSW	1	185252392	splice site	probably benign
R0510:Rab3gap2	UTSW	1	185260508	splice site	probably benign
R0708:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R0711:Rab3gap2	UTSW	1	185249926	missense	probably damaging	0.99
R1135:Rab3gap2	UTSW	1	185275943	missense	possibly damaging	0.95
R1428:Rab3gap2	UTSW	1	185247904	missense	probably damaging	1.00
R1599:Rab3gap2	UTSW	1	185251026	missense	probably benign	0.07
R1758:Rab3gap2	UTSW	1	185283884	missense	probably benign	0.13
R1903:Rab3gap2	UTSW	1	185221902	missense	probably benign
R1929:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R1994:Rab3gap2	UTSW	1	185236024	missense	probably damaging	1.00
R2010:Rab3gap2	UTSW	1	185278281	missense	possibly damaging	0.57
R2102:Rab3gap2	UTSW	1	185282389	missense	probably benign	0.00
R2120:Rab3gap2	UTSW	1	185261367	missense	possibly damaging	0.95
R2219:Rab3gap2	UTSW	1	185275916	missense	probably damaging	0.99
R2259:Rab3gap2	UTSW	1	185221859	missense	probably damaging	1.00
R2270:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R2272:Rab3gap2	UTSW	1	185283542	critical splice donor site	probably null
R3083:Rab3gap2	UTSW	1	185204269	missense	probably benign	0.00
R3776:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R4050:Rab3gap2	UTSW	1	185272643	critical splice donor site	probably null
R4130:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R4176:Rab3gap2	UTSW	1	185246666	missense	probably damaging	0.99
R4296:Rab3gap2	UTSW	1	185255837	critical splice donor site	probably null
R4416:Rab3gap2	UTSW	1	185282347	missense	probably benign	0.00
R4426:Rab3gap2	UTSW	1	185235342	missense	probably damaging	1.00
R4518:Rab3gap2	UTSW	1	185267068	missense	probably benign
R4891:Rab3gap2	UTSW	1	185259366	missense	probably benign	0.00
R4913:Rab3gap2	UTSW	1	185262829	missense	probably benign	0.12
R4955:Rab3gap2	UTSW	1	185267155	intron	probably benign
R5411:Rab3gap2	UTSW	1	185277145	critical splice acceptor site	probably null
R5516:Rab3gap2	UTSW	1	185235487	missense	probably benign	0.02
R5670:Rab3gap2	UTSW	1	185221899	missense	probably benign
R5670:Rab3gap2	UTSW	1	185277205	missense	probably damaging	1.00
R6380:Rab3gap2	UTSW	1	185235984	missense	probably damaging	1.00
R6533:Rab3gap2	UTSW	1	185232954	splice site	probably null
R6655:Rab3gap2	UTSW	1	185250011	missense	probably damaging	1.00
R6676:Rab3gap2	UTSW	1	185283410	missense	probably damaging	1.00
R6726:Rab3gap2	UTSW	1	185247865	missense	probably damaging	0.99
R6969:Rab3gap2	UTSW	1	185236012	missense	probably damaging	1.00
R7151:Rab3gap2	UTSW	1	185248053	missense	probably benign	0.00
R7168:Rab3gap2	UTSW	1	185204297	missense	possibly damaging	0.51
R7196:Rab3gap2	UTSW	1	185281667	missense	probably damaging	1.00
R7201:Rab3gap2	UTSW	1	185267191	missense	probably damaging	1.00
R7371:Rab3gap2	UTSW	1	185251068	missense	probably damaging	1.00
R7573:Rab3gap2	UTSW	1	185282382	missense	probably benign
R7779:Rab3gap2	UTSW	1	185259444	missense	probably damaging	0.98
R7913:Rab3gap2	UTSW	1	185262816	missense	possibly damaging	0.88
R7994:Rab3gap2	UTSW	1	185262816	missense	possibly damaging	0.88
Z1088:Rab3gap2	UTSW	1	185281677	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGGTATTGCAGACAGTG -3'
(R):5'- CAGCAGGTGGAGATGTTTACCTC -3'

Sequencing Primer
(F):5'- GGTATTGCAGACAGTGTAGCC -3'
(R):5'- ATACTCCCAGCAGCAGTGG -3'

Posted On

2015-08-18