Mutagenetix > Incidental Mutation

Incidental Mutation 'R4516:Dzank1'

332897

Institutional Source

Beutler Lab

Gene Symbol

Dzank1

Ensembl Gene

ENSMUSG00000037259

Gene Name

double zinc ribbon and ankyrin repeat domains 1

Synonyms

2810039F03Rik, 6330439K17Rik, Ankrd64

MMRRC Submission

041760-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144470557-144527414 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 144510122 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081982] [ENSMUST00000163701]

AlphaFold

Q8C008

Predicted Effect

probably benign
Transcript: ENSMUST00000081982

SMART Domains

Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259

Domain	Start	End	E-Value	Type
Pfam:CHB_HEX_C	11	99	1.1e-16	PFAM
Pfam:CHB_HEX_C_1	20	97	4.5e-18	PFAM
Pfam:Fn3_assoc	32	100	1.6e-17	PFAM
ZnF_RBZ	268	292	5.44e0	SMART
ZnF_RBZ	307	331	2.55e0	SMART
Blast:ZnF_RBZ	355	378	1e-7	BLAST
ZnF_RBZ	385	409	3.13e0	SMART
low complexity region	591	604	N/A	INTRINSIC
ANK	631	662	2.97e2	SMART
ANK	666	695	2.83e0	SMART
Blast:ANK	700	731	7e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124823

Predicted Effect

probably benign
Transcript: ENSMUST00000163701

SMART Domains

Protein: ENSMUSP00000133177
Gene: ENSMUSG00000037259

Domain	Start	End	E-Value	Type
Pfam:CHB_HEX_C	12	99	1.5e-17	PFAM
Pfam:CHB_HEX_C_1	21	97	8.5e-17	PFAM
Pfam:Fn3_assoc	32	100	3.7e-18	PFAM
ZnF_RBZ	269	293	5.44e0	SMART
ZnF_RBZ	308	332	2.55e0	SMART
Blast:ZnF_RBZ	356	379	1e-7	BLAST
ZnF_RBZ	386	410	3.13e0	SMART
low complexity region	592	605	N/A	INTRINSIC
ANK	632	663	2.97e2	SMART
ANK	667	696	2.83e0	SMART
Blast:ANK	701	732	7e-12	BLAST

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.6%
20x: 92.9%

Validation Efficiency

86% (51/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,517,200		probably benign	Het
4930452B06Rik	A	T	14: 8,536,609	D199E	probably damaging	Het
4932438A13Rik	T	C	3: 36,895,311	S369P	possibly damaging	Het
Bean1	T	C	8: 104,215,154	S211P	probably damaging	Het
Camta1	A	G	4: 151,144,720	S552P	possibly damaging	Het
Cdh11	T	C	8: 102,673,962	T125A	possibly damaging	Het
Cdk5rap2	A	T	4: 70,276,715		probably null	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Cfap44	T	A	16: 44,473,864	Y224*	probably null	Het
Cfap46	G	A	7: 139,660,082		probably benign	Het
Cntrl	G	A	2: 35,127,981	V468I	probably benign	Het
Col6a6	C	T	9: 105,698,949	V2071I	possibly damaging	Het
Coq7	A	T	7: 118,509,907	L306Q	unknown	Het
D7Ertd443e	C	G	7: 134,293,328	Q591H	probably damaging	Het
Dchs1	C	T	7: 105,754,852	V2828M	probably damaging	Het
Elmo1	C	T	13: 20,282,914	T235I	probably benign	Het
Elp3	A	T	14: 65,547,877	F492I	possibly damaging	Het
Espl1	A	G	15: 102,323,236	S90G	probably benign	Het
Fbxl20	T	C	11: 98,095,235		probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gm16286	G	A	18: 80,211,576	M28I	probably benign	Het
Got1	T	C	19: 43,504,841	Y243C	probably damaging	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Kif21a	A	T	15: 90,971,142	M673K	probably benign	Het
Lama3	T	A	18: 12,495,358	D1502E	probably damaging	Het
Limk1	A	G	5: 134,676,786		probably benign	Het
Myo5b	A	G	18: 74,625,674	Y242C	probably damaging	Het
Ncbp1	T	C	4: 46,157,824	V354A	probably damaging	Het
Ncoa2	T	C	1: 13,146,906	D1380G	probably damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Oas1d	A	T	5: 120,919,170	T280S	probably damaging	Het
Olfr1229	T	A	2: 89,282,843	M118L	probably benign	Het
Olfr389	C	T	11: 73,777,040	G96S	probably benign	Het
Pax7	T	G	4: 139,780,793	D307A	probably benign	Het
Pdxdc1	G	A	16: 13,838,346	Q621*	probably null	Het
Rab29	A	T	1: 131,867,731	Y27F	possibly damaging	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Ric1	A	G	19: 29,570,765	T278A	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc47a1	T	C	11: 61,344,513	H498R	probably benign	Het
Tas2r116	T	C	6: 132,856,150	L238P	probably damaging	Het
Tigd5	A	T	15: 75,910,515	R252*	probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Tmem106b	C	T	6: 13,075,099	T95I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn1r174	A	G	7: 23,754,343	I145V	probably benign	Het
Vps26a	T	C	10: 62,468,345	M116V	probably damaging	Het

Other mutations in Dzank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Dzank1	APN	2	144481725	nonsense	probably null
IGL00955:Dzank1	APN	2	144490174	missense	probably benign	0.22
IGL01888:Dzank1	APN	2	144476154	splice site	probably null
IGL02108:Dzank1	APN	2	144506223	missense	probably benign	0.02
IGL02979:Dzank1	APN	2	144488738	missense	probably damaging	1.00
BB008:Dzank1	UTSW	2	144481694	missense	probably benign	0.00
BB018:Dzank1	UTSW	2	144481694	missense	probably benign	0.00
PIT4466001:Dzank1	UTSW	2	144483373	missense	probably benign	0.00
R0388:Dzank1	UTSW	2	144476106	missense	possibly damaging	0.86
R0603:Dzank1	UTSW	2	144511512	missense	probably benign	0.04
R1052:Dzank1	UTSW	2	144513445	missense	probably benign
R1386:Dzank1	UTSW	2	144491831	missense	probably benign	0.05
R1529:Dzank1	UTSW	2	144482188	missense	probably benign	0.01
R1634:Dzank1	UTSW	2	144481669	missense	probably benign	0.01
R2761:Dzank1	UTSW	2	144513449	missense	probably benign
R4024:Dzank1	UTSW	2	144482227	missense	probably benign
R4279:Dzank1	UTSW	2	144491845	missense	probably benign	0.00
R4324:Dzank1	UTSW	2	144488698	missense	possibly damaging	0.95
R4713:Dzank1	UTSW	2	144491804	missense	probably benign	0.13
R4782:Dzank1	UTSW	2	144504399	missense	probably damaging	1.00
R4994:Dzank1	UTSW	2	144522566	missense	probably damaging	1.00
R5157:Dzank1	UTSW	2	144483412	missense	probably damaging	0.98
R5514:Dzank1	UTSW	2	144481685	missense	probably benign	0.01
R5580:Dzank1	UTSW	2	144506178	missense	probably damaging	1.00
R5635:Dzank1	UTSW	2	144483407	missense	probably damaging	1.00
R5793:Dzank1	UTSW	2	144506224	missense	probably benign	0.14
R5820:Dzank1	UTSW	2	144513488	missense	probably damaging	1.00
R5976:Dzank1	UTSW	2	144501489	missense	probably damaging	1.00
R6935:Dzank1	UTSW	2	144476094	missense	possibly damaging	0.64
R6980:Dzank1	UTSW	2	144490136	missense	possibly damaging	0.87
R7331:Dzank1	UTSW	2	144490270	missense	probably benign	0.17
R7691:Dzank1	UTSW	2	144506171	missense	probably damaging	1.00
R7814:Dzank1	UTSW	2	144522564	missense	probably damaging	1.00
R7879:Dzank1	UTSW	2	144491798	missense	probably benign	0.01
R7931:Dzank1	UTSW	2	144481694	missense	probably benign	0.00
R8127:Dzank1	UTSW	2	144488816	missense	probably damaging	1.00
R8192:Dzank1	UTSW	2	144490225	missense	probably benign	0.05
R8314:Dzank1	UTSW	2	144502958	missense	probably damaging	1.00
R8944:Dzank1	UTSW	2	144491809	missense	probably benign	0.00
R9025:Dzank1	UTSW	2	144476092	missense	probably benign	0.04
R9096:Dzank1	UTSW	2	144474962	missense	possibly damaging	0.62
R9097:Dzank1	UTSW	2	144474962	missense	possibly damaging	0.62
R9108:Dzank1	UTSW	2	144522471	missense	probably benign	0.00
R9261:Dzank1	UTSW	2	144513424	missense	probably benign	0.20
R9410:Dzank1	UTSW	2	144482130	critical splice donor site	probably null
R9418:Dzank1	UTSW	2	144513488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGCATTCCATCACTGATTAAAGC -3'
(R):5'- AACGTGGTGTGGGCCTTTAC -3'

Sequencing Primer
(F):5'- TGAACCTCTGAGTTCAAGGC -3'
(R):5'- ACTGGAAGTTTCTAGCTATGAGGAC -3'

Posted On

2015-08-18