Incidental Mutation 'R4516:Hipk1'
ID 332899
Institutional Source Beutler Lab
Gene Symbol Hipk1
Ensembl Gene ENSMUSG00000008730
Gene Name homeodomain interacting protein kinase 1
Synonyms 1110062K04Rik, Myak
MMRRC Submission 041760-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4516 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 103647131-103698879 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103657688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 799 (H799N)
Ref Sequence ENSEMBL: ENSMUSP00000113998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029438] [ENSMUST00000106845] [ENSMUST00000106852] [ENSMUST00000118317] [ENSMUST00000137078]
AlphaFold O88904
Predicted Effect probably damaging
Transcript: ENSMUST00000029438
AA Change: H799N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029438
Gene: ENSMUSG00000008730
AA Change: H799N

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106845
AA Change: H754N

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102458
Gene: ENSMUSG00000008730
AA Change: H754N

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1050 1066 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106852
Predicted Effect probably damaging
Transcript: ENSMUST00000118317
AA Change: H799N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730
AA Change: H799N

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200071
Predicted Effect probably benign
Transcript: ENSMUST00000137078
SMART Domains Protein: ENSMUSP00000120396
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 672 695 N/A INTRINSIC
Meta Mutation Damage Score 0.2934 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, do not develop spontaneous tumors, and are resistant to DMBA-induced skin tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bean1 T C 8: 104,941,786 (GRCm39) S211P probably damaging Het
Bltp1 T C 3: 36,949,460 (GRCm39) S369P possibly damaging Het
Camta1 A G 4: 151,229,177 (GRCm39) S552P possibly damaging Het
Cdh11 T C 8: 103,400,594 (GRCm39) T125A possibly damaging Het
Cdk5rap2 A T 4: 70,194,952 (GRCm39) probably null Het
Cenpc1 A G 5: 86,195,446 (GRCm39) S108P possibly damaging Het
Cfap20dc A T 14: 8,536,609 (GRCm38) D199E probably damaging Het
Cfap44 T A 16: 44,294,227 (GRCm39) Y224* probably null Het
Cfap46 G A 7: 139,239,998 (GRCm39) probably benign Het
Cntrl G A 2: 35,017,993 (GRCm39) V468I probably benign Het
Col6a6 C T 9: 105,576,148 (GRCm39) V2071I possibly damaging Het
Coq7 A T 7: 118,109,130 (GRCm39) L306Q unknown Het
D7Ertd443e C G 7: 133,895,057 (GRCm39) Q591H probably damaging Het
Dchs1 C T 7: 105,404,059 (GRCm39) V2828M probably damaging Het
Dzank1 T A 2: 144,352,042 (GRCm39) probably benign Het
Elmo1 C T 13: 20,467,084 (GRCm39) T235I probably benign Het
Elp3 A T 14: 65,785,326 (GRCm39) F492I possibly damaging Het
Espl1 A G 15: 102,231,671 (GRCm39) S90G probably benign Het
Fbxl20 T C 11: 97,986,061 (GRCm39) probably benign Het
Gm10722 T C 9: 3,000,937 (GRCm39) C6R probably benign Het
Got1 T C 19: 43,493,280 (GRCm39) Y243C probably damaging Het
Kif21a A T 15: 90,855,345 (GRCm39) M673K probably benign Het
Lama3 T A 18: 12,628,415 (GRCm39) D1502E probably damaging Het
Limk1 A G 5: 134,705,640 (GRCm39) probably benign Het
Myo5b A G 18: 74,758,745 (GRCm39) Y242C probably damaging Het
Naa12 G A 18: 80,254,791 (GRCm39) M28I probably benign Het
Ncbp1 T C 4: 46,157,824 (GRCm39) V354A probably damaging Het
Ncoa2 T C 1: 13,217,130 (GRCm39) D1380G probably damaging Het
Ntng1 A G 3: 109,842,329 (GRCm39) I148T probably damaging Het
Oas1d A T 5: 121,057,233 (GRCm39) T280S probably damaging Het
Or1e29 C T 11: 73,667,866 (GRCm39) G96S probably benign Het
Or4c15b T A 2: 89,113,187 (GRCm39) M118L probably benign Het
Pax7 T G 4: 139,508,104 (GRCm39) D307A probably benign Het
Pdxdc1 G A 16: 13,656,210 (GRCm39) Q621* probably null Het
Rab29 A T 1: 131,795,469 (GRCm39) Y27F possibly damaging Het
Rab3gap2 G A 1: 184,999,265 (GRCm39) V991I probably benign Het
Ric1 A G 19: 29,548,165 (GRCm39) T278A probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Slc47a1 T C 11: 61,235,339 (GRCm39) H498R probably benign Het
Spmip6 T C 4: 41,517,200 (GRCm39) probably benign Het
Tas2r116 T C 6: 132,833,113 (GRCm39) L238P probably damaging Het
Tigd5 A T 15: 75,782,364 (GRCm39) R252* probably null Het
Tlr6 A G 5: 65,112,247 (GRCm39) F220S possibly damaging Het
Tmem106b C T 6: 13,075,098 (GRCm39) T95I probably damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Vmn1r174 A G 7: 23,453,768 (GRCm39) I145V probably benign Het
Vps26a T C 10: 62,304,124 (GRCm39) M116V probably damaging Het
Other mutations in Hipk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Hipk1 APN 3 103,685,476 (GRCm39) missense possibly damaging 0.49
IGL01024:Hipk1 APN 3 103,667,952 (GRCm39) missense probably benign 0.31
IGL01069:Hipk1 APN 3 103,685,015 (GRCm39) missense possibly damaging 0.95
IGL01798:Hipk1 APN 3 103,668,875 (GRCm39) missense probably damaging 0.99
IGL01937:Hipk1 APN 3 103,651,320 (GRCm39) missense possibly damaging 0.71
IGL01945:Hipk1 APN 3 103,651,320 (GRCm39) missense possibly damaging 0.71
IGL02184:Hipk1 APN 3 103,666,066 (GRCm39) missense possibly damaging 0.96
IGL02430:Hipk1 APN 3 103,667,971 (GRCm39) missense probably damaging 1.00
IGL02603:Hipk1 APN 3 103,657,588 (GRCm39) missense probably damaging 0.97
IGL02632:Hipk1 APN 3 103,667,861 (GRCm39) missense probably benign 0.14
IGL02686:Hipk1 APN 3 103,685,333 (GRCm39) missense possibly damaging 0.82
IGL03293:Hipk1 APN 3 103,684,575 (GRCm39) missense possibly damaging 0.83
effluvient UTSW 3 103,661,641 (GRCm39) splice site probably null
R0012:Hipk1 UTSW 3 103,670,996 (GRCm39) missense probably damaging 0.98
R0012:Hipk1 UTSW 3 103,670,996 (GRCm39) missense probably damaging 0.98
R0512:Hipk1 UTSW 3 103,667,890 (GRCm39) missense possibly damaging 0.95
R0741:Hipk1 UTSW 3 103,654,128 (GRCm39) missense probably benign 0.17
R0785:Hipk1 UTSW 3 103,661,641 (GRCm39) splice site probably null
R0786:Hipk1 UTSW 3 103,651,620 (GRCm39) missense probably benign
R0833:Hipk1 UTSW 3 103,661,612 (GRCm39) missense probably damaging 0.98
R0836:Hipk1 UTSW 3 103,661,612 (GRCm39) missense probably damaging 0.98
R1165:Hipk1 UTSW 3 103,668,840 (GRCm39) missense possibly damaging 0.62
R1322:Hipk1 UTSW 3 103,651,297 (GRCm39) missense probably damaging 1.00
R1384:Hipk1 UTSW 3 103,666,090 (GRCm39) splice site probably benign
R1521:Hipk1 UTSW 3 103,685,098 (GRCm39) missense probably benign 0.16
R1543:Hipk1 UTSW 3 103,685,480 (GRCm39) missense probably benign 0.00
R2085:Hipk1 UTSW 3 103,657,670 (GRCm39) missense probably benign 0.00
R2158:Hipk1 UTSW 3 103,667,854 (GRCm39) missense probably damaging 1.00
R2291:Hipk1 UTSW 3 103,668,926 (GRCm39) missense probably damaging 1.00
R3522:Hipk1 UTSW 3 103,651,430 (GRCm39) missense probably damaging 0.96
R4518:Hipk1 UTSW 3 103,657,688 (GRCm39) missense probably damaging 0.98
R4884:Hipk1 UTSW 3 103,651,338 (GRCm39) missense possibly damaging 0.47
R5023:Hipk1 UTSW 3 103,684,823 (GRCm39) missense probably damaging 1.00
R6045:Hipk1 UTSW 3 103,654,218 (GRCm39) missense probably benign 0.45
R6641:Hipk1 UTSW 3 103,660,721 (GRCm39) missense probably damaging 0.99
R6904:Hipk1 UTSW 3 103,684,828 (GRCm39) missense possibly damaging 0.90
R6925:Hipk1 UTSW 3 103,685,561 (GRCm39) missense unknown
R7169:Hipk1 UTSW 3 103,651,533 (GRCm39) missense probably benign
R7212:Hipk1 UTSW 3 103,684,926 (GRCm39) nonsense probably null
R7313:Hipk1 UTSW 3 103,685,574 (GRCm39) missense unknown
R7678:Hipk1 UTSW 3 103,667,866 (GRCm39) missense probably damaging 0.98
R8133:Hipk1 UTSW 3 103,660,710 (GRCm39) missense possibly damaging 0.83
R8154:Hipk1 UTSW 3 103,656,652 (GRCm39) missense probably damaging 1.00
R8166:Hipk1 UTSW 3 103,685,489 (GRCm39) missense possibly damaging 0.95
R8941:Hipk1 UTSW 3 103,660,743 (GRCm39) missense probably damaging 0.99
R8989:Hipk1 UTSW 3 103,668,960 (GRCm39) missense possibly damaging 0.80
R9236:Hipk1 UTSW 3 103,671,789 (GRCm39) missense probably damaging 1.00
R9302:Hipk1 UTSW 3 103,685,099 (GRCm39) missense probably benign 0.01
R9383:Hipk1 UTSW 3 103,684,883 (GRCm39) missense probably damaging 0.99
R9401:Hipk1 UTSW 3 103,685,295 (GRCm39) missense probably benign
R9729:Hipk1 UTSW 3 103,668,890 (GRCm39) missense probably damaging 1.00
R9798:Hipk1 UTSW 3 103,651,431 (GRCm39) missense possibly damaging 0.88
Z1088:Hipk1 UTSW 3 103,671,860 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCATGTTAAGCGCAGGACC -3'
(R):5'- ACTTCATATGTAAACAGGCCTTACC -3'

Sequencing Primer
(F):5'- GCAGGACCTAACATAGACTTACTTGG -3'
(R):5'- CTTACCTGATTGGAAAGGACACAGTG -3'
Posted On 2015-08-18