Incidental Mutation 'R0105:Dsg2'
ID33290
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Namedesmoglein 2
SynonymsD18Ertd293e
MMRRC Submission 038391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R0105 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location20558074-20604521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20602054 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1030 (S1030P)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787]
Predicted Effect probably benign
Transcript: ENSMUST00000059787
AA Change: S1030P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: S1030P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130296
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,187,392 V698D probably benign Het
5530400C23Rik G A 6: 133,294,314 R107K probably benign Het
A530053G22Rik T C 6: 60,402,152 noncoding transcript Het
Adcy9 A G 16: 4,288,388 V954A probably damaging Het
Aldh8a1 T A 10: 21,395,539 M388K probably damaging Het
Ankhd1 A G 18: 36,646,766 I1720M probably damaging Het
Atp6v0a4 T C 6: 38,053,129 probably benign Het
C1qtnf4 T A 2: 90,890,363 *327R probably null Het
C1s1 T C 6: 124,541,318 probably benign Het
Cdsn A C 17: 35,556,138 R521S possibly damaging Het
Cgnl1 T C 9: 71,656,102 M848V probably benign Het
Cog3 A G 14: 75,722,140 S591P probably damaging Het
Col6a3 A G 1: 90,798,161 V1375A possibly damaging Het
Cr1l A G 1: 195,112,412 probably benign Het
Crmp1 T A 5: 37,284,135 D520E probably damaging Het
Ctdspl2 T A 2: 121,977,320 probably benign Het
Dnah6 C T 6: 73,155,279 A1147T probably damaging Het
Elavl3 C A 9: 22,036,833 V12F possibly damaging Het
Fam20b T C 1: 156,690,570 E218G probably damaging Het
Fam227a T C 15: 79,620,832 D466G possibly damaging Het
Fto G A 8: 91,522,802 E421K probably damaging Het
Gab2 T C 7: 97,299,072 Y290H probably damaging Het
Gm973 A G 1: 59,582,474 Q591R probably null Het
Gsdmc2 T C 15: 63,828,177 T249A probably benign Het
Il15ra T A 2: 11,730,648 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Il6ra A G 3: 89,876,818 I382T probably damaging Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Krt76 T C 15: 101,884,912 T564A unknown Het
Lhpp T C 7: 132,630,525 S57P probably damaging Het
Lrrk1 G T 7: 66,292,341 D716E probably damaging Het
Mcm3ap T A 10: 76,499,534 D1263E probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mroh7 T C 4: 106,711,270 T48A possibly damaging Het
Nccrp1 T C 7: 28,547,038 D33G probably benign Het
Neurog1 G T 13: 56,251,237 D232E probably benign Het
Olfr1202 T A 2: 88,817,909 V246D probably damaging Het
Olfr1243 T C 2: 89,528,363 T16A probably benign Het
Otog C A 7: 46,288,366 T1833K possibly damaging Het
Perm1 C A 4: 156,218,225 H409N probably benign Het
Pik3r5 A T 11: 68,490,511 E174D probably damaging Het
Pkhd1 G A 1: 20,523,732 Q1386* probably null Het
Pla2r1 T C 2: 60,514,981 R344G possibly damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plekhg4 G A 8: 105,382,012 V1202M possibly damaging Het
Ppil4 A G 10: 7,798,446 Y118C probably damaging Het
Prrc2b G T 2: 32,213,311 E934* probably null Het
Psmb9 A G 17: 34,187,275 F12S probably benign Het
Ptdss2 T C 7: 141,152,880 W183R probably damaging Het
Ptpn4 C T 1: 119,687,605 probably null Het
Reln G A 5: 22,048,815 R600W probably damaging Het
Scml4 T A 10: 42,930,599 V161E probably damaging Het
Sdcbp2 A T 2: 151,589,558 T284S probably benign Het
Slc22a29 T C 19: 8,160,627 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spen T C 4: 141,469,810 probably benign Het
Sumf2 T A 5: 129,849,894 probably benign Het
Tbx10 A G 19: 3,993,121 probably benign Het
Tex10 C A 4: 48,468,957 V73F probably damaging Het
Tgm5 C A 2: 121,077,012 G77W probably damaging Het
Tnfrsf21 T A 17: 43,040,191 probably null Het
Treml2 C T 17: 48,302,828 T96I probably damaging Het
Trim65 T C 11: 116,126,066 *523W probably null Het
Zcchc17 T A 4: 130,349,306 D28V probably benign Het
Zhx2 T C 15: 57,822,695 F487L probably damaging Het
Zkscan6 T A 11: 65,821,985 L248Q probably damaging Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably null
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
R7471:Dsg2 UTSW 18 20580618 missense probably benign 0.08
R7558:Dsg2 UTSW 18 20594234 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTATGCCAAAGGCTCAGCAG -3'
(R):5'- TGCTTCCCACACTAGAGAGCACAG -3'

Sequencing Primer
(F):5'- CACAGAGCCTGATCGTGAC -3'
(R):5'- CTAGAGAGCACAGTGTTCCTAGC -3'
Posted On2013-05-09