Incidental Mutation 'R4516:Limk1'
ID332910
Institutional Source Beutler Lab
Gene Symbol Limk1
Ensembl Gene ENSMUSG00000029674
Gene NameLIM-domain containing, protein kinase
Synonyms
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134656039-134688598 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 134676786 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000015137] [ENSMUST00000111233]
Predicted Effect probably benign
Transcript: ENSMUST00000015137
SMART Domains Protein: ENSMUSP00000015137
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 24 75 5.3e-19 SMART
LIM 83 137 1.73e-9 SMART
PDZ 176 258 1.51e-9 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:Pkinase 339 604 1.7e-49 PFAM
Pfam:Pkinase_Tyr 339 604 1.5e-55 PFAM
Pfam:Kdo 345 509 2.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100641
SMART Domains Protein: ENSMUSP00000098206
Gene: ENSMUSG00000072573

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
low complexity region 48 67 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111233
SMART Domains Protein: ENSMUSP00000106864
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 23 67 2.19e-1 SMART
LIM 75 129 1.73e-9 SMART
PDZ 168 250 1.51e-9 SMART
low complexity region 258 269 N/A INTRINSIC
Pfam:Pkinase_Tyr 331 596 1.5e-56 PFAM
Pfam:Pkinase 331 597 4.7e-50 PFAM
Pfam:Kdo 339 501 1.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132027
Predicted Effect probably benign
Transcript: ENSMUST00000134093
SMART Domains Protein: ENSMUSP00000121718
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 16 60 2.19e-1 SMART
LIM 68 122 1.73e-9 SMART
PDZ 161 243 1.51e-9 SMART
low complexity region 251 262 N/A INTRINSIC
Pfam:Pkinase 324 425 3.9e-16 PFAM
Pfam:Pkinase_Tyr 324 434 5.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: This gene encodes a member of the LIM kinase family of proteins. This protein is a serine/threonine kinase that regulates actin polymerization via phosphorylation and inactivation of the actin binding factor cofilin. This protein also stimulates axon growth and may play a role in brain development. Homozygous knockout mice for this gene exhibit reduced bone mass, abnormal neuronal morphology and altered synaptic function. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal actin cytoskeleton in neurons of the central nervous system and structural abnormalities of the dendritic spines. Long term potentiation is altered and behavioral anomalies are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Limk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Limk1 APN 5 134657900 unclassified probably benign
IGL02029:Limk1 APN 5 134657954 nonsense probably null
IGL02211:Limk1 APN 5 134657637 missense probably damaging 1.00
IGL03000:Limk1 APN 5 134670501 missense probably damaging 0.99
extremist UTSW 5 134670441 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0071:Limk1 UTSW 5 134661391 missense probably benign 0.01
R0180:Limk1 UTSW 5 134669261 missense probably damaging 0.97
R1456:Limk1 UTSW 5 134657510 missense probably benign 0.09
R2225:Limk1 UTSW 5 134661556 splice site probably null
R2379:Limk1 UTSW 5 134679481 unclassified probably benign
R2899:Limk1 UTSW 5 134688300 intron probably null
R3423:Limk1 UTSW 5 134672669 critical splice donor site probably null
R4235:Limk1 UTSW 5 134670478 missense probably benign 0.00
R4566:Limk1 UTSW 5 134686683 missense probably benign 0.12
R4752:Limk1 UTSW 5 134670441 missense probably damaging 1.00
R5682:Limk1 UTSW 5 134665205 critical splice donor site probably null
R5917:Limk1 UTSW 5 134657935 missense probably damaging 1.00
R6163:Limk1 UTSW 5 134657955 missense probably damaging 1.00
R6479:Limk1 UTSW 5 134661519 utr 3 prime probably benign
R6952:Limk1 UTSW 5 134670478 missense possibly damaging 0.76
R7009:Limk1 UTSW 5 134672699 missense probably benign
R7147:Limk1 UTSW 5 134657341 missense probably benign 0.14
R7453:Limk1 UTSW 5 134669237 missense probably damaging 1.00
R7471:Limk1 UTSW 5 134657971 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTCAGGAGCAGCTACATCC -3'
(R):5'- CGTTGCTGATCTAACCAGAGAC -3'

Sequencing Primer
(F):5'- GCAGCTACATCCCACCCTGG -3'
(R):5'- AGGAGTTCAAGGCCATCTTC -3'
Posted On2015-08-18