Mutagenetix > Incidental Mutations

Incidental Mutation 'R4516:Limk1'

332910

Institutional Source

Beutler Lab

Gene Symbol

Limk1

Ensembl Gene

ENSMUSG00000029674

Gene Name

LIM-domain containing, protein kinase

Synonyms

MMRRC Submission

041760-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134656039-134688598 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 134676786 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015137] [ENSMUST00000111233]

Predicted Effect

probably benign
Transcript: ENSMUST00000015137

SMART Domains

Protein: ENSMUSP00000015137
Gene: ENSMUSG00000029674

Domain	Start	End	E-Value	Type
LIM	24	75	5.3e-19	SMART
LIM	83	137	1.73e-9	SMART
PDZ	176	258	1.51e-9	SMART
low complexity region	266	277	N/A	INTRINSIC
Pfam:Pkinase	339	604	1.7e-49	PFAM
Pfam:Pkinase_Tyr	339	604	1.5e-55	PFAM
Pfam:Kdo	345	509	2.5e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100641

SMART Domains

Protein: ENSMUSP00000098206
Gene: ENSMUSG00000072573

Domain	Start	End	E-Value	Type
low complexity region	27	42	N/A	INTRINSIC
low complexity region	48	67	N/A	INTRINSIC
low complexity region	147	158	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111233

SMART Domains

Protein: ENSMUSP00000106864
Gene: ENSMUSG00000029674

Domain	Start	End	E-Value	Type
LIM	23	67	2.19e-1	SMART
LIM	75	129	1.73e-9	SMART
PDZ	168	250	1.51e-9	SMART
low complexity region	258	269	N/A	INTRINSIC
Pfam:Pkinase_Tyr	331	596	1.5e-56	PFAM
Pfam:Pkinase	331	597	4.7e-50	PFAM
Pfam:Kdo	339	501	1.5e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132027

Predicted Effect

probably benign
Transcript: ENSMUST00000134093

SMART Domains

Protein: ENSMUSP00000121718
Gene: ENSMUSG00000029674

Domain	Start	End	E-Value	Type
LIM	16	60	2.19e-1	SMART
LIM	68	122	1.73e-9	SMART
PDZ	161	243	1.51e-9	SMART
low complexity region	251	262	N/A	INTRINSIC
Pfam:Pkinase	324	425	3.9e-16	PFAM
Pfam:Pkinase_Tyr	324	434	5.4e-14	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.6%
20x: 92.9%

Validation Efficiency

86% (51/59)

MGI Phenotype

FUNCTION: This gene encodes a member of the LIM kinase family of proteins. This protein is a serine/threonine kinase that regulates actin polymerization via phosphorylation and inactivation of the actin binding factor cofilin. This protein also stimulates axon growth and may play a role in brain development. Homozygous knockout mice for this gene exhibit reduced bone mass, abnormal neuronal morphology and altered synaptic function. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal actin cytoskeleton in neurons of the central nervous system and structural abnormalities of the dendritic spines. Long term potentiation is altered and behavioral anomalies are seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,517,200		probably benign	Het
4930452B06Rik	A	T	14: 8,536,609	D199E	probably damaging	Het
4932438A13Rik	T	C	3: 36,895,311	S369P	possibly damaging	Het
Bean1	T	C	8: 104,215,154	S211P	probably damaging	Het
Camta1	A	G	4: 151,144,720	S552P	possibly damaging	Het
Cdh11	T	C	8: 102,673,962	T125A	possibly damaging	Het
Cdk5rap2	A	T	4: 70,276,715		probably null	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Cfap44	T	A	16: 44,473,864	Y224*	probably null	Het
Cfap46	G	A	7: 139,660,082		probably benign	Het
Cntrl	G	A	2: 35,127,981	V468I	probably benign	Het
Col6a6	C	T	9: 105,698,949	V2071I	possibly damaging	Het
Coq7	A	T	7: 118,509,907	L306Q	unknown	Het
D7Ertd443e	C	G	7: 134,293,328	Q591H	probably damaging	Het
Dchs1	C	T	7: 105,754,852	V2828M	probably damaging	Het
Dzank1	T	A	2: 144,510,122		probably benign	Het
Elmo1	C	T	13: 20,282,914	T235I	probably benign	Het
Elp3	A	T	14: 65,547,877	F492I	possibly damaging	Het
Espl1	A	G	15: 102,323,236	S90G	probably benign	Het
Fbxl20	T	C	11: 98,095,235		probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gm16286	G	A	18: 80,211,576	M28I	probably benign	Het
Got1	T	C	19: 43,504,841	Y243C	probably damaging	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Kif21a	A	T	15: 90,971,142	M673K	probably benign	Het
Lama3	T	A	18: 12,495,358	D1502E	probably damaging	Het
Myo5b	A	G	18: 74,625,674	Y242C	probably damaging	Het
Ncbp1	T	C	4: 46,157,824	V354A	probably damaging	Het
Ncoa2	T	C	1: 13,146,906	D1380G	probably damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Oas1d	A	T	5: 120,919,170	T280S	probably damaging	Het
Olfr1229	T	A	2: 89,282,843	M118L	probably benign	Het
Olfr389	C	T	11: 73,777,040	G96S	probably benign	Het
Pax7	T	G	4: 139,780,793	D307A	probably benign	Het
Pdxdc1	G	A	16: 13,838,346	Q621*	probably null	Het
Rab29	A	T	1: 131,867,731	Y27F	possibly damaging	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Ric1	A	G	19: 29,570,765	T278A	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc47a1	T	C	11: 61,344,513	H498R	probably benign	Het
Tas2r116	T	C	6: 132,856,150	L238P	probably damaging	Het
Tigd5	A	T	15: 75,910,515	R252*	probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Tmem106b	C	T	6: 13,075,099	T95I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn1r174	A	G	7: 23,754,343	I145V	probably benign	Het
Vps26a	T	C	10: 62,468,345	M116V	probably damaging	Het

Other mutations in Limk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01355:Limk1	APN	5	134657900	unclassified	probably benign
IGL02029:Limk1	APN	5	134657954	nonsense	probably null
IGL02211:Limk1	APN	5	134657637	missense	probably damaging	1.00
IGL03000:Limk1	APN	5	134670501	missense	probably damaging	0.99
extremist	UTSW	5	134670441	missense	probably damaging	1.00
R0046:Limk1	UTSW	5	134672761	missense	probably damaging	1.00
R0046:Limk1	UTSW	5	134672761	missense	probably damaging	1.00
R0058:Limk1	UTSW	5	134659871	missense	probably damaging	1.00
R0058:Limk1	UTSW	5	134659871	missense	probably damaging	1.00
R0071:Limk1	UTSW	5	134661391	missense	probably benign	0.01
R0180:Limk1	UTSW	5	134669261	missense	probably damaging	0.97
R1456:Limk1	UTSW	5	134657510	missense	probably benign	0.09
R2225:Limk1	UTSW	5	134661556	splice site	probably null
R2379:Limk1	UTSW	5	134679481	unclassified	probably benign
R2899:Limk1	UTSW	5	134688300	splice site	probably null
R3423:Limk1	UTSW	5	134672669	critical splice donor site	probably null
R4235:Limk1	UTSW	5	134670478	missense	probably benign	0.00
R4566:Limk1	UTSW	5	134686683	missense	probably benign	0.12
R4752:Limk1	UTSW	5	134670441	missense	probably damaging	1.00
R5682:Limk1	UTSW	5	134665205	critical splice donor site	probably null
R5917:Limk1	UTSW	5	134657935	missense	probably damaging	1.00
R6163:Limk1	UTSW	5	134657955	missense	probably damaging	1.00
R6479:Limk1	UTSW	5	134661519	utr 3 prime	probably benign
R6952:Limk1	UTSW	5	134670478	missense	possibly damaging	0.76
R7009:Limk1	UTSW	5	134672699	missense	probably benign
R7147:Limk1	UTSW	5	134657341	missense	probably benign	0.14
R7453:Limk1	UTSW	5	134669237	missense	probably damaging	1.00
R7471:Limk1	UTSW	5	134657971	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTCAGGAGCAGCTACATCC -3'
(R):5'- CGTTGCTGATCTAACCAGAGAC -3'

Sequencing Primer
(F):5'- GCAGCTACATCCCACCCTGG -3'
(R):5'- AGGAGTTCAAGGCCATCTTC -3'

Posted On

2015-08-18