Incidental Mutation 'R4516:D7Ertd443e'
ID332917
Institutional Source Beutler Lab
Gene Symbol D7Ertd443e
Ensembl Gene ENSMUSG00000030994
Gene NameDNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location134265779-134385661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 134293328 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 591 (Q591H)
Ref Sequence ENSEMBL: ENSMUSP00000134479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094002] [ENSMUST00000106129] [ENSMUST00000172947] [ENSMUST00000174700]
Predicted Effect probably damaging
Transcript: ENSMUST00000094002
AA Change: Q544H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091539
Gene: ENSMUSG00000030994
AA Change: Q544H

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Pfam:ALMS_motif 511 644 3.7e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106129
AA Change: Q185H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101735
Gene: ENSMUSG00000030994
AA Change: Q185H

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
low complexity region 119 135 N/A INTRINSIC
Pfam:ALMS_motif 152 285 7.4e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172947
AA Change: Q591H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134479
Gene: ENSMUSG00000030994
AA Change: Q591H

DomainStartEndE-ValueType
low complexity region 226 239 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 525 541 N/A INTRINSIC
Pfam:ALMS_motif 559 689 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174700
SMART Domains Protein: ENSMUSP00000134411
Gene: ENSMUSG00000030994

DomainStartEndE-ValueType
Pfam:ALMS_motif 25 98 2.3e-12 PFAM
Meta Mutation Damage Score 0.2856 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in D7Ertd443e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:D7Ertd443e APN 7 134349400 missense possibly damaging 0.56
R0369:D7Ertd443e UTSW 7 134298137 missense possibly damaging 0.56
R0501:D7Ertd443e UTSW 7 134294972 missense probably damaging 1.00
R1073:D7Ertd443e UTSW 7 134270218 missense probably damaging 1.00
R1083:D7Ertd443e UTSW 7 134348934 nonsense probably null
R1744:D7Ertd443e UTSW 7 134349413 missense probably benign 0.00
R1801:D7Ertd443e UTSW 7 134270212 missense probably damaging 1.00
R1807:D7Ertd443e UTSW 7 134293305 missense probably null 1.00
R2050:D7Ertd443e UTSW 7 134266798 missense probably damaging 1.00
R2273:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2274:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2504:D7Ertd443e UTSW 7 134349479 unclassified probably null
R3699:D7Ertd443e UTSW 7 134349068 missense probably damaging 1.00
R4348:D7Ertd443e UTSW 7 134348953 frame shift probably null
R5123:D7Ertd443e UTSW 7 134349668 unclassified probably null
R5440:D7Ertd443e UTSW 7 134349275 missense probably damaging 0.96
R5555:D7Ertd443e UTSW 7 134349591 missense probably benign 0.00
R5711:D7Ertd443e UTSW 7 134349381 missense probably benign 0.43
R5848:D7Ertd443e UTSW 7 134349722 missense possibly damaging 0.92
R6049:D7Ertd443e UTSW 7 134298232 missense probably benign 0.01
R6266:D7Ertd443e UTSW 7 134349785 missense probably damaging 1.00
R6408:D7Ertd443e UTSW 7 134349711 missense probably benign 0.27
R6939:D7Ertd443e UTSW 7 134364479 intron probably null
R7195:D7Ertd443e UTSW 7 134295122 missense probably damaging 1.00
R7352:D7Ertd443e UTSW 7 134349394 missense probably benign 0.03
R7737:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R7843:D7Ertd443e UTSW 7 134349095 missense possibly damaging 0.93
R7845:D7Ertd443e UTSW 7 134270248 missense probably damaging 1.00
R7926:D7Ertd443e UTSW 7 134349095 missense possibly damaging 0.93
R7928:D7Ertd443e UTSW 7 134270248 missense probably damaging 1.00
Z1088:D7Ertd443e UTSW 7 134294982 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATCCTTTCAGTGAAGGCTCC -3'
(R):5'- GAGGCAGGGGTTATATTTGCAC -3'

Sequencing Primer
(F):5'- CATGCCTGAGAATGTTTGTCC -3'
(R):5'- AGTATTGTGATCTTGATTGGATCCC -3'
Posted On2015-08-18