Mutagenetix > Incidental Mutation

Incidental Mutation 'R4516:Bean1'

332920

Institutional Source

Beutler Lab

Gene Symbol

Bean1

Ensembl Gene

ENSMUSG00000031872

Gene Name

brain expressed, associated with Nedd4, 1

Synonyms

MMRRC Submission

041760-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104170442-104219122 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104215154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 211 (S211P)

Ref Sequence

ENSEMBL: ENSMUSP00000148571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]

AlphaFold

Q9EQG5

Predicted Effect

probably damaging
Transcript: ENSMUST00000093245
AA Change: S140P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872
AA Change: S140P

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164076
AA Change: S79P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872
AA Change: S79P

Domain	Start	End	E-Value	Type
low complexity region	156	171	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167633
AA Change: S140P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872
AA Change: S140P

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171018
AA Change: S211P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872
AA Change: S211P

Domain	Start	End	E-Value	Type
transmembrane domain	72	94	N/A	INTRINSIC
low complexity region	104	124	N/A	INTRINSIC
low complexity region	288	303	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212627

Predicted Effect

probably damaging
Transcript: ENSMUST00000212979
AA Change: S211P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000213077
AA Change: S35P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.0803

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.6%
20x: 92.9%

Validation Efficiency

86% (51/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,517,200		probably benign	Het
4930452B06Rik	A	T	14: 8,536,609	D199E	probably damaging	Het
4932438A13Rik	T	C	3: 36,895,311	S369P	possibly damaging	Het
Camta1	A	G	4: 151,144,720	S552P	possibly damaging	Het
Cdh11	T	C	8: 102,673,962	T125A	possibly damaging	Het
Cdk5rap2	A	T	4: 70,276,715		probably null	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Cfap44	T	A	16: 44,473,864	Y224*	probably null	Het
Cfap46	G	A	7: 139,660,082		probably benign	Het
Cntrl	G	A	2: 35,127,981	V468I	probably benign	Het
Col6a6	C	T	9: 105,698,949	V2071I	possibly damaging	Het
Coq7	A	T	7: 118,509,907	L306Q	unknown	Het
D7Ertd443e	C	G	7: 134,293,328	Q591H	probably damaging	Het
Dchs1	C	T	7: 105,754,852	V2828M	probably damaging	Het
Dzank1	T	A	2: 144,510,122		probably benign	Het
Elmo1	C	T	13: 20,282,914	T235I	probably benign	Het
Elp3	A	T	14: 65,547,877	F492I	possibly damaging	Het
Espl1	A	G	15: 102,323,236	S90G	probably benign	Het
Fbxl20	T	C	11: 98,095,235		probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gm16286	G	A	18: 80,211,576	M28I	probably benign	Het
Got1	T	C	19: 43,504,841	Y243C	probably damaging	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Kif21a	A	T	15: 90,971,142	M673K	probably benign	Het
Lama3	T	A	18: 12,495,358	D1502E	probably damaging	Het
Limk1	A	G	5: 134,676,786		probably benign	Het
Myo5b	A	G	18: 74,625,674	Y242C	probably damaging	Het
Ncbp1	T	C	4: 46,157,824	V354A	probably damaging	Het
Ncoa2	T	C	1: 13,146,906	D1380G	probably damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Oas1d	A	T	5: 120,919,170	T280S	probably damaging	Het
Olfr1229	T	A	2: 89,282,843	M118L	probably benign	Het
Olfr389	C	T	11: 73,777,040	G96S	probably benign	Het
Pax7	T	G	4: 139,780,793	D307A	probably benign	Het
Pdxdc1	G	A	16: 13,838,346	Q621*	probably null	Het
Rab29	A	T	1: 131,867,731	Y27F	possibly damaging	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Ric1	A	G	19: 29,570,765	T278A	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc47a1	T	C	11: 61,344,513	H498R	probably benign	Het
Tas2r116	T	C	6: 132,856,150	L238P	probably damaging	Het
Tigd5	A	T	15: 75,910,515	R252*	probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Tmem106b	C	T	6: 13,075,099	T95I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn1r174	A	G	7: 23,754,343	I145V	probably benign	Het
Vps26a	T	C	10: 62,468,345	M116V	probably damaging	Het

Other mutations in Bean1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02016:Bean1	APN	8	104210918	missense	possibly damaging	0.90
R0135:Bean1	UTSW	8	104217175	missense	probably damaging	1.00
R0490:Bean1	UTSW	8	104215028	missense	possibly damaging	0.76
R1319:Bean1	UTSW	8	104217224	missense	probably benign
R1920:Bean1	UTSW	8	104211110	missense	possibly damaging	0.92
R2513:Bean1	UTSW	8	104182011	missense	probably benign	0.04
R3980:Bean1	UTSW	8	104211098	missense	possibly damaging	0.92
R4209:Bean1	UTSW	8	104213934	start codon destroyed	probably null	0.04
R4369:Bean1	UTSW	8	104217110	missense	probably damaging	1.00
R4542:Bean1	UTSW	8	104210959	missense	probably damaging	1.00
R4663:Bean1	UTSW	8	104211167	missense	probably damaging	1.00
R4962:Bean1	UTSW	8	104216974	missense	probably damaging	1.00
R5221:Bean1	UTSW	8	104215152	missense	probably damaging	1.00
R6288:Bean1	UTSW	8	104210990	missense	probably damaging	1.00
R6588:Bean1	UTSW	8	104182032	frame shift	probably null
R6615:Bean1	UTSW	8	104182032	frame shift	probably null
R6994:Bean1	UTSW	8	104182032	frame shift	probably null
R7359:Bean1	UTSW	8	104182032	frame shift	probably null
R7451:Bean1	UTSW	8	104213996	missense	probably benign	0.01
R7454:Bean1	UTSW	8	104211026	missense	probably damaging	1.00
R7473:Bean1	UTSW	8	104182032	frame shift	probably null
R7537:Bean1	UTSW	8	104182032	frame shift	probably null
R7826:Bean1	UTSW	8	104182032	frame shift	probably null
R8034:Bean1	UTSW	8	104182032	frame shift	probably null
R8418:Bean1	UTSW	8	104182032	frame shift	probably null
R8789:Bean1	UTSW	8	104182032	frame shift	probably null
R8885:Bean1	UTSW	8	104182120	critical splice donor site	probably null
R8888:Bean1	UTSW	8	104182032	frame shift	probably null
R8892:Bean1	UTSW	8	104216978	missense	probably damaging	1.00
R8896:Bean1	UTSW	8	104182032	frame shift	probably null
R8992:Bean1	UTSW	8	104182032	frame shift	probably null
R9015:Bean1	UTSW	8	104182032	frame shift	probably null
R9113:Bean1	UTSW	8	104213925	missense	probably benign	0.00
R9122:Bean1	UTSW	8	104182032	frame shift	probably null
R9135:Bean1	UTSW	8	104182032	frame shift	probably null
R9151:Bean1	UTSW	8	104182032	frame shift	probably null
R9255:Bean1	UTSW	8	104182032	frame shift	probably null
R9340:Bean1	UTSW	8	104182107	missense	probably damaging	0.99
R9363:Bean1	UTSW	8	104182032	frame shift	probably null
R9417:Bean1	UTSW	8	104182032	frame shift	probably null
R9537:Bean1	UTSW	8	104182032	frame shift	probably null
R9566:Bean1	UTSW	8	104182032	frame shift	probably null
R9731:Bean1	UTSW	8	104182032	frame shift	probably null
RF054:Bean1	UTSW	8	104182032	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTCAGATAGATGGCTACTGTGC -3'
(R):5'- AGCTGGTGTCTGTAGTCCAC -3'

Sequencing Primer
(F):5'- GCTACTGTGCGGGAAGTC -3'
(R):5'- GGCAGCATCTCCCAAGTCATG -3'

Posted On

2015-08-18