Mutagenetix > Incidental Mutations

Incidental Mutation 'R4516:Col6a6'

332921

Institutional Source

Beutler Lab

Gene Symbol

Col6a6

Ensembl Gene

ENSMUSG00000043719

Gene Name

collagen, type VI, alpha 6

Synonyms

E330026B02Rik

MMRRC Submission

041760-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R4516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105687809-105828160 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 105698949 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 2071 (V2071I)

Ref Sequence

ENSEMBL: ENSMUSP00000125765 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]

Predicted Effect

probably benign
Transcript: ENSMUST00000098441
AA Change: V2071I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: V2071I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	3.3e-9	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166431
AA Change: V2071I

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: V2071I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	9.3e-10	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Meta Mutation Damage Score

0.008

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.6%
20x: 92.9%

Validation Efficiency

86% (51/59)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,517,200		probably benign	Het
4930452B06Rik	A	T	14: 8,536,609	D199E	probably damaging	Het
4932438A13Rik	T	C	3: 36,895,311	S369P	possibly damaging	Het
Bean1	T	C	8: 104,215,154	S211P	probably damaging	Het
Camta1	A	G	4: 151,144,720	S552P	possibly damaging	Het
Cdh11	T	C	8: 102,673,962	T125A	possibly damaging	Het
Cdk5rap2	A	T	4: 70,276,715		probably null	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Cfap44	T	A	16: 44,473,864	Y224*	probably null	Het
Cfap46	G	A	7: 139,660,082		probably benign	Het
Cntrl	G	A	2: 35,127,981	V468I	probably benign	Het
Coq7	A	T	7: 118,509,907	L306Q	unknown	Het
D7Ertd443e	C	G	7: 134,293,328	Q591H	probably damaging	Het
Dchs1	C	T	7: 105,754,852	V2828M	probably damaging	Het
Dzank1	T	A	2: 144,510,122		probably benign	Het
Elmo1	C	T	13: 20,282,914	T235I	probably benign	Het
Elp3	A	T	14: 65,547,877	F492I	possibly damaging	Het
Espl1	A	G	15: 102,323,236	S90G	probably benign	Het
Fbxl20	T	C	11: 98,095,235		probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gm16286	G	A	18: 80,211,576	M28I	probably benign	Het
Got1	T	C	19: 43,504,841	Y243C	probably damaging	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Kif21a	A	T	15: 90,971,142	M673K	probably benign	Het
Lama3	T	A	18: 12,495,358	D1502E	probably damaging	Het
Limk1	A	G	5: 134,676,786		probably benign	Het
Myo5b	A	G	18: 74,625,674	Y242C	probably damaging	Het
Ncbp1	T	C	4: 46,157,824	V354A	probably damaging	Het
Ncoa2	T	C	1: 13,146,906	D1380G	probably damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Oas1d	A	T	5: 120,919,170	T280S	probably damaging	Het
Olfr1229	T	A	2: 89,282,843	M118L	probably benign	Het
Olfr389	C	T	11: 73,777,040	G96S	probably benign	Het
Pax7	T	G	4: 139,780,793	D307A	probably benign	Het
Pdxdc1	G	A	16: 13,838,346	Q621*	probably null	Het
Rab29	A	T	1: 131,867,731	Y27F	possibly damaging	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Ric1	A	G	19: 29,570,765	T278A	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc47a1	T	C	11: 61,344,513	H498R	probably benign	Het
Tas2r116	T	C	6: 132,856,150	L238P	probably damaging	Het
Tigd5	A	T	15: 75,910,515	R252*	probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Tmem106b	C	T	6: 13,075,099	T95I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn1r174	A	G	7: 23,754,343	I145V	probably benign	Het
Vps26a	T	C	10: 62,468,345	M116V	probably damaging	Het

Other mutations in Col6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Col6a6	APN	9	105758191	critical splice acceptor site	probably null
IGL00768:Col6a6	APN	9	105782412	missense	probably benign	0.04
IGL00917:Col6a6	APN	9	105784254	splice site	probably benign
IGL01385:Col6a6	APN	9	105783666	missense	probably damaging	1.00
IGL01411:Col6a6	APN	9	105785958	nonsense	probably null
IGL01508:Col6a6	APN	9	105727166	splice site	probably benign
IGL01668:Col6a6	APN	9	105709271	missense	probably damaging	1.00
IGL01733:Col6a6	APN	9	105709255	missense	possibly damaging	0.92
IGL01932:Col6a6	APN	9	105689626	missense	probably benign	0.02
IGL01934:Col6a6	APN	9	105698659	critical splice donor site	probably null
IGL01944:Col6a6	APN	9	105783909	missense	probably damaging	1.00
IGL01980:Col6a6	APN	9	105780985	missense	probably damaging	0.96
IGL02114:Col6a6	APN	9	105767199	critical splice donor site	probably null
IGL02129:Col6a6	APN	9	105736340	splice site	probably benign
IGL02201:Col6a6	APN	9	105780995	missense	probably damaging	1.00
IGL02335:Col6a6	APN	9	105784101	missense	probably damaging	1.00
IGL02541:Col6a6	APN	9	105732216	missense	probably benign	0.05
IGL02574:Col6a6	APN	9	105782191	missense	probably damaging	1.00
IGL02649:Col6a6	APN	9	105727170	critical splice donor site	probably null
IGL02852:Col6a6	APN	9	105784073	missense	probably damaging	0.99
IGL03278:Col6a6	APN	9	105709452	missense	probably benign	0.01
IGL03327:Col6a6	APN	9	105767234	missense	possibly damaging	0.90
PIT4519001:Col6a6	UTSW	9	105732263	missense	probably benign	0.23
R0042:Col6a6	UTSW	9	105780697	missense	possibly damaging	0.89
R0046:Col6a6	UTSW	9	105748848	splice site	probably benign
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0140:Col6a6	UTSW	9	105702275	missense	probably damaging	1.00
R0278:Col6a6	UTSW	9	105767288	missense	possibly damaging	0.87
R0281:Col6a6	UTSW	9	105784116	missense	probably benign	0.13
R0382:Col6a6	UTSW	9	105755555	missense	probably damaging	0.98
R0389:Col6a6	UTSW	9	105784204	missense	probably benign	0.02
R0421:Col6a6	UTSW	9	105784206	missense	probably benign	0.02
R0502:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0503:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0600:Col6a6	UTSW	9	105761440	missense	probably damaging	1.00
R0626:Col6a6	UTSW	9	105777744	missense	probably benign	0.45
R0629:Col6a6	UTSW	9	105727165	splice site	probably benign
R0690:Col6a6	UTSW	9	105709486	missense	probably benign	0.01
R1155:Col6a6	UTSW	9	105782090	missense	possibly damaging	0.64
R1245:Col6a6	UTSW	9	105748910	missense	possibly damaging	0.62
R1253:Col6a6	UTSW	9	105774303	missense	probably null	0.98
R1263:Col6a6	UTSW	9	105709489	missense	probably benign	0.01
R1296:Col6a6	UTSW	9	105781091	missense	probably damaging	1.00
R1556:Col6a6	UTSW	9	105709473	missense	possibly damaging	0.82
R1600:Col6a6	UTSW	9	105778075	missense	probably damaging	1.00
R1612:Col6a6	UTSW	9	105777549	missense	probably damaging	1.00
R1613:Col6a6	UTSW	9	105732211	critical splice donor site	probably null
R1830:Col6a6	UTSW	9	105702270	missense	probably damaging	0.99
R1858:Col6a6	UTSW	9	105781102	missense	probably damaging	1.00
R1897:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R1944:Col6a6	UTSW	9	105709384	missense	probably damaging	1.00
R2366:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R2484:Col6a6	UTSW	9	105780804	missense	probably damaging	0.98
R3079:Col6a6	UTSW	9	105754223	missense	probably benign	0.01
R3176:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3276:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3429:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R3716:Col6a6	UTSW	9	105782174	missense	probably damaging	0.98
R3809:Col6a6	UTSW	9	105780692	missense	probably damaging	1.00
R3978:Col6a6	UTSW	9	105698879	missense	probably damaging	0.98
R4087:Col6a6	UTSW	9	105783956	missense	possibly damaging	0.68
R4382:Col6a6	UTSW	9	105783690	missense	probably damaging	1.00
R4666:Col6a6	UTSW	9	105767342	missense	possibly damaging	0.93
R4905:Col6a6	UTSW	9	105767424	missense	probably damaging	1.00
R4923:Col6a6	UTSW	9	105788948	missense	probably damaging	1.00
R4951:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R5002:Col6a6	UTSW	9	105786093	missense	probably benign	0.00
R5111:Col6a6	UTSW	9	105709474	missense	possibly damaging	0.70
R5205:Col6a6	UTSW	9	105782033	missense	probably damaging	0.99
R5399:Col6a6	UTSW	9	105709107	missense	possibly damaging	0.50
R5475:Col6a6	UTSW	9	105774338	missense	probably null	0.79
R5491:Col6a6	UTSW	9	105738236	missense	probably damaging	0.98
R5758:Col6a6	UTSW	9	105761518	critical splice acceptor site	probably null
R5934:Col6a6	UTSW	9	105767075	missense	probably damaging	1.00
R6059:Col6a6	UTSW	9	105783917	missense	probably damaging	1.00
R6284:Col6a6	UTSW	9	105727227	splice site	probably null
R6425:Col6a6	UTSW	9	105698865	missense	probably benign	0.21
R6464:Col6a6	UTSW	9	105788953	start codon destroyed	probably null	0.60
R6469:Col6a6	UTSW	9	105698691	missense	probably damaging	0.97
R6520:Col6a6	UTSW	9	105785825	missense	possibly damaging	0.89
R6552:Col6a6	UTSW	9	105698913	missense	probably damaging	1.00
R6750:Col6a6	UTSW	9	105783680	missense	probably damaging	1.00
R6813:Col6a6	UTSW	9	105783941	missense	probably benign	0.32
R7032:Col6a6	UTSW	9	105767508	missense	probably damaging	0.96
R7260:Col6a6	UTSW	9	105783969	missense	probably benign	0.00
R7472:Col6a6	UTSW	9	105782423	missense	probably damaging	1.00
R7541:Col6a6	UTSW	9	105767324	missense	probably damaging	1.00
X0022:Col6a6	UTSW	9	105699332	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCCTTGTCATCCCAGTCAGG -3'
(R):5'- GGCACTGCTAGATCACTTCG -3'

Sequencing Primer
(F):5'- TCAGGGCCCAAGGAAAAGAC -3'
(R):5'- GGCACTGCTAGATCACTTCGAAATC -3'

Posted On

2015-08-18