Incidental Mutation 'R4516:Slc47a1'
ID332923
Institutional Source Beutler Lab
Gene Symbol Slc47a1
Ensembl Gene ENSMUSG00000010122
Gene Namesolute carrier family 47, member 1
SynonymsmMATE1, 1300013J15Rik, MATE1
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61343401-61378345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61344513 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 498 (H498R)
Ref Sequence ENSEMBL: ENSMUSP00000010267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010267] [ENSMUST00000093029] [ENSMUST00000131723] [ENSMUST00000134423]
Predicted Effect probably benign
Transcript: ENSMUST00000010267
AA Change: H498R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010267
Gene: ENSMUSG00000010122
AA Change: H498R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 204 4.8e-34 PFAM
low complexity region 225 236 N/A INTRINSIC
Pfam:MatE 265 426 1.6e-32 PFAM
low complexity region 442 452 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093029
SMART Domains Protein: ENSMUSP00000090710
Gene: ENSMUSG00000069855

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 1.7e-35 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 4e-34 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131723
SMART Domains Protein: ENSMUSP00000115132
Gene: ENSMUSG00000010122

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 180 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134423
SMART Domains Protein: ENSMUSP00000120907
Gene: ENSMUSG00000069855

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 3.5e-32 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 1.7e-36 PFAM
transmembrane domain 444 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147450
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It encodes a protein of unknown function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased blood urea nitrogen, increased circulating creatinine, and abnormal metformin pahrmacokinetics including increased plasma and tissue concentration with decreased kidney and liver clearance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Slc47a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Slc47a1 APN 11 61370124 missense probably damaging 1.00
IGL02399:Slc47a1 APN 11 61363058 missense probably damaging 1.00
IGL02586:Slc47a1 APN 11 61344321 missense probably benign 0.14
IGL02832:Slc47a1 APN 11 61363413 missense probably benign 0.01
IGL02873:Slc47a1 APN 11 61362817 unclassified probably benign
IGL03038:Slc47a1 APN 11 61353092 missense probably benign 0.14
R0392:Slc47a1 UTSW 11 61371782 missense probably damaging 1.00
R0927:Slc47a1 UTSW 11 61373422 missense probably damaging 0.96
R1255:Slc47a1 UTSW 11 61370148 missense probably damaging 1.00
R1507:Slc47a1 UTSW 11 61359518 critical splice donor site probably null
R1625:Slc47a1 UTSW 11 61371799 missense probably damaging 1.00
R2029:Slc47a1 UTSW 11 61378007 intron probably benign
R2137:Slc47a1 UTSW 11 61344492 missense probably benign 0.21
R2434:Slc47a1 UTSW 11 61367722 splice site probably null
R3115:Slc47a1 UTSW 11 61367680 missense possibly damaging 0.88
R3752:Slc47a1 UTSW 11 61344381 missense possibly damaging 0.84
R3839:Slc47a1 UTSW 11 61353058 splice site probably benign
R4499:Slc47a1 UTSW 11 61359529 missense probably benign
R4675:Slc47a1 UTSW 11 61363031 missense probably benign 0.41
R4727:Slc47a1 UTSW 11 61363451 missense possibly damaging 0.48
R4839:Slc47a1 UTSW 11 61373350 splice site probably null
R4869:Slc47a1 UTSW 11 61362694 missense probably benign 0.02
R5164:Slc47a1 UTSW 11 61353060 splice site probably null
R5633:Slc47a1 UTSW 11 61369261 missense probably damaging 1.00
R5957:Slc47a1 UTSW 11 61344342 missense probably benign 0.06
R6793:Slc47a1 UTSW 11 61359403 missense probably benign
R6952:Slc47a1 UTSW 11 61344454 missense probably benign 0.04
R7082:Slc47a1 UTSW 11 61377941 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCAAGTTGCTGGATTGATGG -3'
(R):5'- TGCAGCATCGCCCTAAGATG -3'

Sequencing Primer
(F):5'- GCTGGATTGATGGCATTCCC -3'
(R):5'- ATCGCCCTAAGATGCTTGC -3'
Posted On2015-08-18