Incidental Mutation 'R4516:Fbxl20'
ID332925
Institutional Source Beutler Lab
Gene Symbol Fbxl20
Ensembl Gene ENSMUSG00000020883
Gene NameF-box and leucine-rich repeat protein 20
Synonyms2610511F20Rik, C86145, 4632423N09Rik, Fbl2, Scrapper, Scr
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98082556-98150403 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 98095235 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103143] [ENSMUST00000147971] [ENSMUST00000150378]
Predicted Effect probably benign
Transcript: ENSMUST00000103143
SMART Domains Protein: ENSMUSP00000099432
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
FBOX 28 68 2.62e-8 SMART
LRR 90 115 2.02e-1 SMART
LRR 116 141 1.77e1 SMART
LRR 142 167 7.9e-4 SMART
LRR_CC 168 193 4.61e-5 SMART
LRR 194 219 7.15e-2 SMART
LRR 220 245 1.67e-2 SMART
LRR 246 271 1.2e-3 SMART
LRR 272 297 2.61e-4 SMART
LRR 298 323 1.26e-2 SMART
LRR_CC 324 349 1.77e-6 SMART
LRR 353 377 6.06e2 SMART
LRR 378 403 2.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135969
Predicted Effect probably benign
Transcript: ENSMUST00000147971
SMART Domains Protein: ENSMUSP00000123507
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
LRR 14 39 7.15e-2 SMART
LRR 40 65 1.67e-2 SMART
LRR 66 91 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150378
SMART Domains Protein: ENSMUSP00000119003
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
FBOX 30 70 2.62e-8 SMART
LRR 92 117 3.69e1 SMART
LRR 121 146 7.9e-4 SMART
LRR_CC 147 172 4.61e-5 SMART
LRR 173 198 7.15e-2 SMART
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL20, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, shortened lifespans, decreased body size and altered CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Fbxl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00161:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00590:Fbxl20 APN 11 98093129 missense probably damaging 1.00
IGL00944:Fbxl20 APN 11 98113242 missense probably damaging 1.00
IGL00966:Fbxl20 APN 11 98110974 missense probably damaging 1.00
IGL01344:Fbxl20 APN 11 98100100 nonsense probably null
IGL02394:Fbxl20 APN 11 98113256 missense probably damaging 1.00
R0270:Fbxl20 UTSW 11 98098503 splice site probably benign
R1564:Fbxl20 UTSW 11 98098486 missense probably damaging 1.00
R2227:Fbxl20 UTSW 11 98090849 missense probably benign 0.12
R3902:Fbxl20 UTSW 11 98097035 missense probably benign 0.03
R4158:Fbxl20 UTSW 11 98095394 unclassified probably benign
R4916:Fbxl20 UTSW 11 98128360 missense probably damaging 1.00
R5905:Fbxl20 UTSW 11 98115445 missense probably damaging 1.00
R6791:Fbxl20 UTSW 11 98109510 missense probably benign 0.05
R6916:Fbxl20 UTSW 11 98113253 missense possibly damaging 0.78
R7381:Fbxl20 UTSW 11 98090788 missense probably benign 0.01
R7536:Fbxl20 UTSW 11 98095383 nonsense probably null
X0067:Fbxl20 UTSW 11 98096978 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TCTGTACTTCCCAAGCCAGC -3'
(R):5'- TGATTGCATCACCCTGAAGTG -3'

Sequencing Primer
(F):5'- CAGGTTCTAGTGGCCCGTG -3'
(R):5'- CATCACCCTGAAGTGTGGTG -3'
Posted On2015-08-18