Mutagenetix > Incidental Mutation

Incidental Mutation 'R4516:Espl1'

332930

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

041760-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4516 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102323236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 90 (S90G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000169637] [ENSMUST00000170627] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000001335

SMART Domains

Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
SCOP:d1fxkc_	12	58	4e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062492

SMART Domains

Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: S1956G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: S1956G

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165671

SMART Domains

Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165717

SMART Domains

Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	72	1.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166658

SMART Domains

Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	22	143	8.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168805

Predicted Effect

probably benign
Transcript: ENSMUST00000169637

SMART Domains

Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	58	3.4e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170627

SMART Domains

Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	7	99	4.6e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: S1956G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000229942
AA Change: S90G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231207

Meta Mutation Damage Score

0.0590

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.6%
20x: 92.9%

Validation Efficiency

86% (51/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,517,200		probably benign	Het
4930452B06Rik	A	T	14: 8,536,609	D199E	probably damaging	Het
4932438A13Rik	T	C	3: 36,895,311	S369P	possibly damaging	Het
Bean1	T	C	8: 104,215,154	S211P	probably damaging	Het
Camta1	A	G	4: 151,144,720	S552P	possibly damaging	Het
Cdh11	T	C	8: 102,673,962	T125A	possibly damaging	Het
Cdk5rap2	A	T	4: 70,276,715		probably null	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Cfap44	T	A	16: 44,473,864	Y224*	probably null	Het
Cfap46	G	A	7: 139,660,082		probably benign	Het
Cntrl	G	A	2: 35,127,981	V468I	probably benign	Het
Col6a6	C	T	9: 105,698,949	V2071I	possibly damaging	Het
Coq7	A	T	7: 118,509,907	L306Q	unknown	Het
D7Ertd443e	C	G	7: 134,293,328	Q591H	probably damaging	Het
Dchs1	C	T	7: 105,754,852	V2828M	probably damaging	Het
Dzank1	T	A	2: 144,510,122		probably benign	Het
Elmo1	C	T	13: 20,282,914	T235I	probably benign	Het
Elp3	A	T	14: 65,547,877	F492I	possibly damaging	Het
Fbxl20	T	C	11: 98,095,235		probably benign	Het
Gm10722	T	C	9: 3,000,937	C6R	probably benign	Het
Gm16286	G	A	18: 80,211,576	M28I	probably benign	Het
Got1	T	C	19: 43,504,841	Y243C	probably damaging	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Kif21a	A	T	15: 90,971,142	M673K	probably benign	Het
Lama3	T	A	18: 12,495,358	D1502E	probably damaging	Het
Limk1	A	G	5: 134,676,786		probably benign	Het
Myo5b	A	G	18: 74,625,674	Y242C	probably damaging	Het
Ncbp1	T	C	4: 46,157,824	V354A	probably damaging	Het
Ncoa2	T	C	1: 13,146,906	D1380G	probably damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Oas1d	A	T	5: 120,919,170	T280S	probably damaging	Het
Olfr1229	T	A	2: 89,282,843	M118L	probably benign	Het
Olfr389	C	T	11: 73,777,040	G96S	probably benign	Het
Pax7	T	G	4: 139,780,793	D307A	probably benign	Het
Pdxdc1	G	A	16: 13,838,346	Q621*	probably null	Het
Rab29	A	T	1: 131,867,731	Y27F	possibly damaging	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Ric1	A	G	19: 29,570,765	T278A	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc47a1	T	C	11: 61,344,513	H498R	probably benign	Het
Tas2r116	T	C	6: 132,856,150	L238P	probably damaging	Het
Tigd5	A	T	15: 75,910,515	R252*	probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Tmem106b	C	T	6: 13,075,099	T95I	probably damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn1r174	A	G	7: 23,754,343	I145V	probably benign	Het
Vps26a	T	C	10: 62,468,345	M116V	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGGCTGTTGGGTAAAGCC -3'
(R):5'- CTGGCAGACAACGATAGAGC -3'

Sequencing Primer
(F):5'- GCTGTTGGGTAAAGCCTAAGG -3'
(R):5'- CAGACAACGATAGAGCAGAGG -3'

Posted On

2015-08-18