Incidental Mutation 'R4516:Myo5b'
ID332934
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74625674 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 242 (Y242C)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: Y242C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: Y242C

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120161
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: Y242C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: Y242C

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Meta Mutation Damage Score 0.9531 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm16286 G A 18: 80,211,576 M28I probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTAGGAGGAGTCTGAGCACTTG -3'
(R):5'- AGATTTGTGGACACTGGAGGC -3'

Sequencing Primer
(F):5'- AGTCTGAGCACTTGACTGAC -3'
(R):5'- ACACTGGAGGCTTAGTCCACATG -3'
Posted On2015-08-18