Incidental Mutation 'R4516:Gm16286'
ID332935
Institutional Source Beutler Lab
Gene Symbol Gm16286
Ensembl Gene ENSMUSG00000024571
Gene Namepredicted gene 16286
Synonyms
MMRRC Submission 041760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4516 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80206765-80212741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80211576 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 28 (M28I)
Ref Sequence ENSEMBL: ENSMUSP00000121883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025463] [ENSMUST00000025464] [ENSMUST00000125127] [ENSMUST00000127234] [ENSMUST00000145963]
Predicted Effect probably benign
Transcript: ENSMUST00000025463
AA Change: M28I

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025463
Gene: ENSMUSG00000024571
AA Change: M28I

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 32 125 7.1e-8 PFAM
Pfam:Acetyltransf_7 40 130 2e-9 PFAM
Pfam:Acetyltransf_1 46 129 6.1e-18 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025464
SMART Domains Protein: ENSMUSP00000025464
Gene: ENSMUSG00000057130

DomainStartEndE-ValueType
Pfam:DIM1 4 93 4.1e-49 PFAM
Pfam:Thioredoxin 8 91 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125127
AA Change: M28I

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123193
Gene: ENSMUSG00000024571
AA Change: M28I

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 40 129 2.3e-9 PFAM
Pfam:Acetyltransf_1 46 129 1e-17 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126360
Predicted Effect probably benign
Transcript: ENSMUST00000127234
AA Change: M28I

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121883
Gene: ENSMUSG00000024571
AA Change: M28I

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 32 125 7.1e-8 PFAM
Pfam:Acetyltransf_7 40 130 2e-9 PFAM
Pfam:Acetyltransf_1 46 129 6.1e-18 PFAM
Pfam:FR47 56 137 2.9e-10 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145116
Predicted Effect probably benign
Transcript: ENSMUST00000145963
SMART Domains Protein: ENSMUSP00000115320
Gene: ENSMUSG00000057130

DomainStartEndE-ValueType
Pfam:DIM1 4 136 3.4e-73 PFAM
Pfam:Thioredoxin 8 109 3.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156400
Meta Mutation Damage Score 0.0943 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.9%
Validation Efficiency 86% (51/59)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,517,200 probably benign Het
4930452B06Rik A T 14: 8,536,609 D199E probably damaging Het
4932438A13Rik T C 3: 36,895,311 S369P possibly damaging Het
Bean1 T C 8: 104,215,154 S211P probably damaging Het
Camta1 A G 4: 151,144,720 S552P possibly damaging Het
Cdh11 T C 8: 102,673,962 T125A possibly damaging Het
Cdk5rap2 A T 4: 70,276,715 probably null Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Cfap44 T A 16: 44,473,864 Y224* probably null Het
Cfap46 G A 7: 139,660,082 probably benign Het
Cntrl G A 2: 35,127,981 V468I probably benign Het
Col6a6 C T 9: 105,698,949 V2071I possibly damaging Het
Coq7 A T 7: 118,509,907 L306Q unknown Het
D7Ertd443e C G 7: 134,293,328 Q591H probably damaging Het
Dchs1 C T 7: 105,754,852 V2828M probably damaging Het
Dzank1 T A 2: 144,510,122 probably benign Het
Elmo1 C T 13: 20,282,914 T235I probably benign Het
Elp3 A T 14: 65,547,877 F492I possibly damaging Het
Espl1 A G 15: 102,323,236 S90G probably benign Het
Fbxl20 T C 11: 98,095,235 probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Got1 T C 19: 43,504,841 Y243C probably damaging Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Kif21a A T 15: 90,971,142 M673K probably benign Het
Lama3 T A 18: 12,495,358 D1502E probably damaging Het
Limk1 A G 5: 134,676,786 probably benign Het
Myo5b A G 18: 74,625,674 Y242C probably damaging Het
Ncbp1 T C 4: 46,157,824 V354A probably damaging Het
Ncoa2 T C 1: 13,146,906 D1380G probably damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Oas1d A T 5: 120,919,170 T280S probably damaging Het
Olfr1229 T A 2: 89,282,843 M118L probably benign Het
Olfr389 C T 11: 73,777,040 G96S probably benign Het
Pax7 T G 4: 139,780,793 D307A probably benign Het
Pdxdc1 G A 16: 13,838,346 Q621* probably null Het
Rab29 A T 1: 131,867,731 Y27F possibly damaging Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Ric1 A G 19: 29,570,765 T278A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc47a1 T C 11: 61,344,513 H498R probably benign Het
Tas2r116 T C 6: 132,856,150 L238P probably damaging Het
Tigd5 A T 15: 75,910,515 R252* probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Tmem106b C T 6: 13,075,099 T95I probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r174 A G 7: 23,754,343 I145V probably benign Het
Vps26a T C 10: 62,468,345 M116V probably damaging Het
Other mutations in Gm16286
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0408:Gm16286 UTSW 18 80211814 missense probably damaging 1.00
R1748:Gm16286 UTSW 18 80211946 missense probably benign 0.00
R4012:Gm16286 UTSW 18 80212124 missense probably benign 0.30
R5460:Gm16286 UTSW 18 80211923 missense probably damaging 1.00
R5464:Gm16286 UTSW 18 80211923 missense probably damaging 1.00
R7413:Gm16286 UTSW 18 80211659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTCAATTCCTCGAGGCAAACG -3'
(R):5'- AAGTTCTCAATCATGGCCCTGG -3'

Sequencing Primer
(F):5'- CAAACGGTGCTGGTGTCG -3'
(R):5'- AAGCCTGGTCCATGAGCTTCTG -3'
Posted On2015-08-18