Incidental Mutation 'R4517:Glb1l'
ID332939
Institutional Source Beutler Lab
Gene Symbol Glb1l
Ensembl Gene ENSMUSG00000026200
Gene Namegalactosidase, beta 1-like
Synonyms4833408P15Rik
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75198236-75210813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75208703 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 121 (C121Y)
Ref Sequence ENSEMBL: ENSMUSP00000140820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027401] [ENSMUST00000113623] [ENSMUST00000123825] [ENSMUST00000144355] [ENSMUST00000155716] [ENSMUST00000185448] [ENSMUST00000188460] [ENSMUST00000189698] [ENSMUST00000191108]
Predicted Effect probably benign
Transcript: ENSMUST00000027401
SMART Domains Protein: ENSMUSP00000027401
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 290 3.3e-47 PFAM
Pfam:Pkinase_Tyr 21 290 3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113623
AA Change: C121Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109253
Gene: ENSMUSG00000026200
AA Change: C121Y

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.1e-123 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123825
SMART Domains Protein: ENSMUSP00000122688
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142052
Predicted Effect probably benign
Transcript: ENSMUST00000144355
SMART Domains Protein: ENSMUSP00000115964
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145144
Predicted Effect probably damaging
Transcript: ENSMUST00000155716
AA Change: C121Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136285
Gene: ENSMUSG00000026200
AA Change: C121Y

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.2e-125 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184844
Predicted Effect probably damaging
Transcript: ENSMUST00000185448
AA Change: C121Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140820
Gene: ENSMUSG00000026200
AA Change: C121Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 188 1.6e-71 PFAM
Pfam:Glyco_hydro_42 48 188 6.4e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186173
AA Change: C115Y
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186492
Predicted Effect probably benign
Transcript: ENSMUST00000188460
SMART Domains Protein: ENSMUSP00000139998
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 172 1e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189242
Predicted Effect probably benign
Transcript: ENSMUST00000189698
SMART Domains Protein: ENSMUSP00000140329
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 203 1.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191108
SMART Domains Protein: ENSMUSP00000139846
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 186 8.6e-29 PFAM
Pfam:Pkinase_Tyr 21 184 2.1e-14 PFAM
Meta Mutation Damage Score 0.9623 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Glb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Glb1l APN 1 75201238 missense probably damaging 0.99
IGL01477:Glb1l APN 1 75208706 missense probably damaging 1.00
R0408:Glb1l UTSW 1 75208835 missense probably damaging 1.00
R0620:Glb1l UTSW 1 75199720 missense probably damaging 1.00
R1639:Glb1l UTSW 1 75199601 missense probably benign 0.16
R1842:Glb1l UTSW 1 75200460 missense probably damaging 0.96
R2508:Glb1l UTSW 1 75201829 missense probably damaging 0.99
R2920:Glb1l UTSW 1 75209190 missense probably benign
R3439:Glb1l UTSW 1 75202620 missense probably damaging 1.00
R4096:Glb1l UTSW 1 75209440 start codon destroyed probably benign 0.01
R4829:Glb1l UTSW 1 75200350 missense probably damaging 0.96
R4851:Glb1l UTSW 1 75208884 unclassified probably benign
R4859:Glb1l UTSW 1 75200319 splice site probably benign
R4951:Glb1l UTSW 1 75208375 missense probably damaging 1.00
R6163:Glb1l UTSW 1 75201407 missense probably benign
R6519:Glb1l UTSW 1 75201056 missense probably benign 0.41
R6693:Glb1l UTSW 1 75209101 missense probably damaging 1.00
R6713:Glb1l UTSW 1 75202417 missense probably benign 0.02
R6833:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R6834:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R7068:Glb1l UTSW 1 75202737 missense probably damaging 1.00
R7453:Glb1l UTSW 1 75202706 missense probably damaging 1.00
R7694:Glb1l UTSW 1 75201792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTACAGACAGGTTTTATCTGC -3'
(R):5'- GAAAGAATGGCTCAGAACCTCTTTC -3'

Sequencing Primer
(F):5'- CAGACAGGTTTTATCTGCTGTAAAG -3'
(R):5'- CAAGTTCTGAGTCTCCTAGGGAAC -3'
Posted On2015-08-18