Incidental Mutation 'R4517:Fap'
ID332940
Institutional Source Beutler Lab
Gene Symbol Fap
Ensembl Gene ENSMUSG00000000392
Gene Namefibroblast activation protein
Synonyms
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62500943-62574075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62530715 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 391 (I391V)
Ref Sequence ENSEMBL: ENSMUSP00000000402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000174234] [ENSMUST00000174448]
Predicted Effect probably benign
Transcript: ENSMUST00000000402
AA Change: I391V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: I391V

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:DPPIV_N 73 440 2e-110 PFAM
Pfam:Abhydrolase_5 504 719 2.4e-12 PFAM
Pfam:Abhydrolase_6 515 703 2.3e-10 PFAM
Pfam:Peptidase_S9 520 727 9.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102732
AA Change: I424V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: I424V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 106 473 1.9e-106 PFAM
Pfam:Abhydrolase_5 537 752 2.9e-12 PFAM
Pfam:Peptidase_S9 553 760 1.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172676
Predicted Effect probably benign
Transcript: ENSMUST00000174234
AA Change: I399V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: I399V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 82 448 4.1e-108 PFAM
Pfam:Abhydrolase_5 512 727 6.4e-12 PFAM
Pfam:Abhydrolase_6 523 711 8.9e-10 PFAM
Pfam:Peptidase_S9 528 735 5.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174448
AA Change: I419V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: I419V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 101 468 2.2e-110 PFAM
Pfam:Abhydrolase_5 532 747 2.5e-12 PFAM
Pfam:Abhydrolase_6 541 731 2.4e-10 PFAM
Pfam:Peptidase_S9 548 755 1e-59 PFAM
Meta Mutation Damage Score 0.1367 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Fap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fap APN 2 62524201 missense possibly damaging 0.82
IGL01420:Fap APN 2 62504502 splice site probably benign
IGL01485:Fap APN 2 62544311 missense possibly damaging 0.80
IGL01987:Fap APN 2 62528676 missense probably damaging 1.00
IGL02198:Fap APN 2 62554798 missense probably benign
IGL02355:Fap APN 2 62573498 missense probably benign 0.02
IGL02362:Fap APN 2 62573498 missense probably benign 0.02
IGL03227:Fap APN 2 62530763 critical splice acceptor site probably null
IGL03266:Fap APN 2 62537022 missense probably benign
IGL03369:Fap APN 2 62503355 splice site probably benign
IGL03406:Fap APN 2 62542122 splice site probably benign
ANU74:Fap UTSW 2 62547769 missense probably damaging 1.00
R0254:Fap UTSW 2 62503402 missense probably damaging 1.00
R0842:Fap UTSW 2 62537001 missense probably damaging 1.00
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1591:Fap UTSW 2 62553857 missense probably damaging 0.99
R1671:Fap UTSW 2 62553835 missense possibly damaging 0.46
R1674:Fap UTSW 2 62519005 missense probably benign
R1795:Fap UTSW 2 62548589 missense probably damaging 1.00
R1869:Fap UTSW 2 62528727 missense probably damaging 1.00
R2032:Fap UTSW 2 62542237 missense probably benign 0.43
R2136:Fap UTSW 2 62524207 missense possibly damaging 0.94
R3546:Fap UTSW 2 62519011 missense probably damaging 1.00
R3547:Fap UTSW 2 62519011 missense probably damaging 1.00
R3771:Fap UTSW 2 62533010 missense probably damaging 1.00
R3801:Fap UTSW 2 62546650 missense probably benign 0.04
R3910:Fap UTSW 2 62556104 missense probably damaging 1.00
R4306:Fap UTSW 2 62530707 critical splice donor site probably null
R4323:Fap UTSW 2 62503372 missense probably damaging 0.97
R4793:Fap UTSW 2 62544369 missense probably damaging 1.00
R4812:Fap UTSW 2 62519021 missense probably damaging 1.00
R4843:Fap UTSW 2 62544374 missense probably damaging 1.00
R5281:Fap UTSW 2 62532961 critical splice donor site probably null
R5661:Fap UTSW 2 62536963 intron probably benign
R5696:Fap UTSW 2 62502459 missense probably damaging 1.00
R5750:Fap UTSW 2 62528714 missense probably damaging 1.00
R5898:Fap UTSW 2 62573503 missense probably benign
R5907:Fap UTSW 2 62544356 missense probably damaging 1.00
R5944:Fap UTSW 2 62542261 missense probably damaging 1.00
R5991:Fap UTSW 2 62518521 missense probably damaging 1.00
R6110:Fap UTSW 2 62554770 missense possibly damaging 0.91
R6270:Fap UTSW 2 62547788 missense probably damaging 0.98
R6505:Fap UTSW 2 62546603 nonsense probably null
R6631:Fap UTSW 2 62503381 missense probably damaging 1.00
R6896:Fap UTSW 2 62504600 nonsense probably null
R7138:Fap UTSW 2 62542178 missense probably benign 0.10
R7806:Fap UTSW 2 62503414 missense probably damaging 1.00
R8000:Fap UTSW 2 62502798 critical splice donor site probably null
R8115:Fap UTSW 2 62519041 missense probably benign 0.07
X0017:Fap UTSW 2 62556180 missense probably benign 0.04
X0026:Fap UTSW 2 62512390 missense probably damaging 1.00
Z1176:Fap UTSW 2 62528774 missense possibly damaging 0.87
Z1177:Fap UTSW 2 62502446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTTTTCAGGATGAGTTGGC -3'
(R):5'- AGTAAATGCCCCAACACAGTTATTC -3'

Sequencing Primer
(F):5'- GCTAATTCTTTGGGTGCATATGAC -3'
(R):5'- ACACAGTTATTCACAGCAGTAATTC -3'
Posted On2015-08-18