Incidental Mutation 'R4517:Whrn'
ID 332942
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms 1110035G07Rik, wi, Ush2d, Dfnb31, C430046P22Rik
MMRRC Submission 041761-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4517 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 63333147-63414228 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 63379517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294] [ENSMUST00000133425]
AlphaFold Q80VW5
Predicted Effect probably null
Transcript: ENSMUST00000063650
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000063672
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084510
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102867
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107393
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140720
Predicted Effect probably null
Transcript: ENSMUST00000133425
SMART Domains Protein: ENSMUSP00000119280
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDZ 1 65 6.42e-13 SMART
internal_repeat_1 139 164 3.88e-7 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153307
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,835 (GRCm39) H181R possibly damaging Het
B4galnt4 A G 7: 140,647,635 (GRCm39) K408E probably damaging Het
Cd209a T A 8: 3,795,525 (GRCm39) D123V probably damaging Het
Cyp4f37 A G 17: 32,850,566 (GRCm39) I340V probably benign Het
Echs1 A G 7: 139,692,409 (GRCm39) S113P possibly damaging Het
Fap T C 2: 62,361,059 (GRCm39) I391V probably benign Het
Glb1l C T 1: 75,185,347 (GRCm39) C121Y probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Gpc5 T A 14: 115,789,651 (GRCm39) N508K possibly damaging Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Ibsp C A 5: 104,453,863 (GRCm39) S67* probably null Het
Ifit1bl2 C T 19: 34,607,164 (GRCm39) probably benign Het
Iqgap2 A G 13: 95,800,569 (GRCm39) probably null Het
Kcnma1 A G 14: 23,387,097 (GRCm39) S982P probably damaging Het
Kif5b T C 18: 6,213,272 (GRCm39) S707G probably benign Het
Lrrk2 A G 15: 91,589,323 (GRCm39) I437V probably benign Het
Mapkbp1 T C 2: 119,855,545 (GRCm39) probably benign Het
Mcu T C 10: 59,303,456 (GRCm39) Y127C probably damaging Het
Mlst8 T C 17: 24,695,031 (GRCm39) Y284C probably damaging Het
Nr2f2 T G 7: 70,007,870 (GRCm39) N204T probably benign Het
Or13a26 A G 7: 140,285,004 (GRCm39) Y280C probably damaging Het
Or7a42 T A 10: 78,791,877 (GRCm39) Y279* probably null Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Pcf11 T C 7: 92,295,696 (GRCm39) Y1451C probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Rttn T C 18: 89,047,097 (GRCm39) S920P probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Tas2r135 A T 6: 42,383,013 (GRCm39) H184L probably benign Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Vmn2r102 A G 17: 19,901,475 (GRCm39) Y534C probably damaging Het
Wdr62 A G 7: 29,969,683 (GRCm39) V259A probably damaging Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63,391,015 (GRCm39) missense probably damaging 1.00
IGL01643:Whrn APN 4 63,334,672 (GRCm39) missense possibly damaging 0.79
IGL02065:Whrn APN 4 63,336,822 (GRCm39) missense possibly damaging 0.52
IGL02119:Whrn APN 4 63,353,724 (GRCm39) missense probably damaging 0.99
IGL02589:Whrn APN 4 63,336,334 (GRCm39) nonsense probably null
IGL02638:Whrn APN 4 63,337,709 (GRCm39) missense possibly damaging 0.47
IGL02865:Whrn APN 4 63,333,729 (GRCm39) missense probably benign 0.08
IGL02934:Whrn APN 4 63,334,342 (GRCm39) missense probably damaging 1.00
IGL03372:Whrn APN 4 63,336,855 (GRCm39) missense probably damaging 0.96
R0090:Whrn UTSW 4 63,350,969 (GRCm39) missense possibly damaging 0.79
R0592:Whrn UTSW 4 63,333,804 (GRCm39) missense probably damaging 1.00
R0631:Whrn UTSW 4 63,337,726 (GRCm39) missense probably damaging 1.00
R1916:Whrn UTSW 4 63,412,969 (GRCm39) missense probably damaging 1.00
R1933:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R1958:Whrn UTSW 4 63,353,666 (GRCm39) missense possibly damaging 0.62
R2255:Whrn UTSW 4 63,336,385 (GRCm39) missense possibly damaging 0.92
R2513:Whrn UTSW 4 63,353,649 (GRCm39) missense probably benign 0.22
R3699:Whrn UTSW 4 63,379,649 (GRCm39) splice site probably benign
R3919:Whrn UTSW 4 63,413,421 (GRCm39) nonsense probably null
R4016:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R4241:Whrn UTSW 4 63,351,210 (GRCm39) unclassified probably benign
R4739:Whrn UTSW 4 63,336,402 (GRCm39) missense probably damaging 1.00
R5207:Whrn UTSW 4 63,350,951 (GRCm39) missense probably damaging 1.00
R5281:Whrn UTSW 4 63,336,664 (GRCm39) missense probably benign 0.04
R5307:Whrn UTSW 4 63,350,080 (GRCm39) missense probably benign 0.01
R5463:Whrn UTSW 4 63,351,053 (GRCm39) missense probably benign 0.08
R5663:Whrn UTSW 4 63,336,685 (GRCm39) missense probably damaging 0.98
R5754:Whrn UTSW 4 63,334,825 (GRCm39) missense probably damaging 0.98
R5933:Whrn UTSW 4 63,412,945 (GRCm39) missense probably damaging 1.00
R6212:Whrn UTSW 4 63,412,923 (GRCm39) nonsense probably null
R6380:Whrn UTSW 4 63,336,829 (GRCm39) missense possibly damaging 0.90
R6381:Whrn UTSW 4 63,390,921 (GRCm39) missense probably benign 0.00
R7030:Whrn UTSW 4 63,413,368 (GRCm39) unclassified probably benign
R7350:Whrn UTSW 4 63,350,196 (GRCm39) missense possibly damaging 0.71
R7382:Whrn UTSW 4 63,336,573 (GRCm39) missense probably benign
R7419:Whrn UTSW 4 63,334,330 (GRCm39) missense possibly damaging 0.94
R8334:Whrn UTSW 4 63,413,047 (GRCm39) missense probably damaging 1.00
R9378:Whrn UTSW 4 63,350,079 (GRCm39) missense probably benign 0.00
X0009:Whrn UTSW 4 63,350,148 (GRCm39) missense probably benign 0.00
Z1176:Whrn UTSW 4 63,333,803 (GRCm39) missense probably damaging 1.00
Z1177:Whrn UTSW 4 63,336,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGGCATCAGCAGTGTTTG -3'
(R):5'- TGGCTTCCTCCAGGTTAATG -3'

Sequencing Primer
(F):5'- CATTAGTCTCAAAAGAGCTGGGCTG -3'
(R):5'- GGCTTCCTCCAGGTTAATGTACTTG -3'
Posted On 2015-08-18