Incidental Mutation 'R4517:Plekhn1'
ID332943
Institutional Source Beutler Lab
Gene Symbol Plekhn1
Ensembl Gene ENSMUSG00000078485
Gene Namepleckstrin homology domain containing, family N member 1
Synonyms
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location156221456-156234857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156225531 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 109 (S109G)
Ref Sequence ENSEMBL: ENSMUSP00000151799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105569] [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105569
SMART Domains Protein: ENSMUSP00000101194
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
low complexity region 20 50 N/A INTRINSIC
BTB 90 187 3.55e-30 SMART
BACK 192 294 1.08e-42 SMART
Kelch 341 387 4.01e-8 SMART
Kelch 388 434 5.41e-14 SMART
Kelch 435 481 6.97e-17 SMART
Kelch 482 528 1.55e-14 SMART
Kelch 529 575 2.02e-13 SMART
Kelch 576 622 1.34e-9 SMART
low complexity region 626 640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105571
AA Change: S109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485
AA Change: S109G

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184043
Predicted Effect probably damaging
Transcript: ENSMUST00000217885
AA Change: S109G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218699
AA Change: S109G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Meta Mutation Damage Score 0.2474 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Plekhn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL00473:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL02104:Plekhn1 APN 4 156222408 missense probably benign 0.25
IGL02122:Plekhn1 APN 4 156223856 critical splice donor site probably null
IGL02210:Plekhn1 APN 4 156223649 missense probably damaging 1.00
PIT4142001:Plekhn1 UTSW 4 156224940 nonsense probably null
PIT4366001:Plekhn1 UTSW 4 156224811 missense probably damaging 0.99
R0123:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0134:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0225:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0276:Plekhn1 UTSW 4 156228246 missense probably damaging 0.99
R0282:Plekhn1 UTSW 4 156228323 splice site probably benign
R0540:Plekhn1 UTSW 4 156222747 missense possibly damaging 0.87
R0569:Plekhn1 UTSW 4 156225201 missense probably damaging 1.00
R0656:Plekhn1 UTSW 4 156225364 missense possibly damaging 0.55
R0798:Plekhn1 UTSW 4 156228263 missense probably damaging 0.96
R0848:Plekhn1 UTSW 4 156223564 critical splice donor site probably null
R1803:Plekhn1 UTSW 4 156222381 missense probably benign 0.20
R2168:Plekhn1 UTSW 4 156221882 missense probably damaging 0.99
R2356:Plekhn1 UTSW 4 156222701 missense probably damaging 1.00
R2516:Plekhn1 UTSW 4 156222659 missense probably damaging 1.00
R3746:Plekhn1 UTSW 4 156225594 missense probably benign 0.00
R3818:Plekhn1 UTSW 4 156225533 missense probably damaging 1.00
R3902:Plekhn1 UTSW 4 156225669 missense possibly damaging 0.75
R4024:Plekhn1 UTSW 4 156224750 missense probably damaging 1.00
R4057:Plekhn1 UTSW 4 156224693 unclassified probably null
R4176:Plekhn1 UTSW 4 156221801 missense probably benign 0.02
R4402:Plekhn1 UTSW 4 156225356 missense probably damaging 1.00
R4405:Plekhn1 UTSW 4 156225273 splice site probably null
R4477:Plekhn1 UTSW 4 156223399 missense probably damaging 1.00
R4515:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4518:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R5086:Plekhn1 UTSW 4 156222424 missense probably benign 0.00
R5092:Plekhn1 UTSW 4 156224765 missense possibly damaging 0.93
R5201:Plekhn1 UTSW 4 156230527 missense probably benign 0.00
R5896:Plekhn1 UTSW 4 156223874 missense probably benign 0.02
R5913:Plekhn1 UTSW 4 156222695 missense probably damaging 1.00
R6124:Plekhn1 UTSW 4 156225239 missense possibly damaging 0.87
R6244:Plekhn1 UTSW 4 156230558 synonymous probably null
R6263:Plekhn1 UTSW 4 156225193 critical splice donor site probably null
R6430:Plekhn1 UTSW 4 156221804 missense probably benign 0.00
R6703:Plekhn1 UTSW 4 156224793 missense probably benign 0.00
R6723:Plekhn1 UTSW 4 156224569 missense probably damaging 1.00
R6741:Plekhn1 UTSW 4 156221792 missense probably damaging 0.98
R7057:Plekhn1 UTSW 4 156233917 missense probably damaging 0.99
R7135:Plekhn1 UTSW 4 156223335 missense probably benign 0.04
R7347:Plekhn1 UTSW 4 156222671 missense probably benign 0.00
R7408:Plekhn1 UTSW 4 156233961 missense probably benign 0.14
R7423:Plekhn1 UTSW 4 156230685 missense probably benign 0.15
R7500:Plekhn1 UTSW 4 156233314 missense probably benign 0.19
R7613:Plekhn1 UTSW 4 156224820 missense probably benign 0.00
R7626:Plekhn1 UTSW 4 156225653 missense probably benign 0.00
R7738:Plekhn1 UTSW 4 156232234 missense probably damaging 1.00
R8065:Plekhn1 UTSW 4 156228240 missense possibly damaging 0.75
R8067:Plekhn1 UTSW 4 156228240 missense possibly damaging 0.75
X0023:Plekhn1 UTSW 4 156222354 missense possibly damaging 0.76
X0065:Plekhn1 UTSW 4 156224915 critical splice donor site probably null
Z1176:Plekhn1 UTSW 4 156223431 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCACCTGGAATGTAAGTCCCTC -3'
(R):5'- TACAGAAGCTGTGTGTATATCGC -3'

Sequencing Primer
(F):5'- TGTAAGTCCCTCAGAACCATGGG -3'
(R):5'- ATATCGCTTGGGGATCCGGC -3'
Posted On2015-08-18