Incidental Mutation 'R4517:Tas2r135'
ID332946
Institutional Source Beutler Lab
Gene Symbol Tas2r135
Ensembl Gene ENSMUSG00000056203
Gene Nametaste receptor, type 2, member 135
Synonymsmt2r38, Tas2r35
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42405434-42406526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42406079 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 184 (H184L)
Ref Sequence ENSEMBL: ENSMUSP00000070247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
Predicted Effect probably benign
Transcript: ENSMUST00000057398
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070178
AA Change: H184L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203
AA Change: H184L

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Tas2r135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Tas2r135 APN 6 42406144 missense probably benign 0.00
IGL01395:Tas2r135 APN 6 42405912 nonsense probably null
IGL02479:Tas2r135 APN 6 42405751 nonsense probably null
IGL02526:Tas2r135 APN 6 42406280 missense probably damaging 1.00
IGL02806:Tas2r135 APN 6 42406448 missense probably benign 0.00
IGL02982:Tas2r135 APN 6 42406253 missense probably benign
IGL03057:Tas2r135 APN 6 42401127 unclassified probably benign
R0057:Tas2r135 UTSW 6 42406420 missense probably benign 0.07
R0104:Tas2r135 UTSW 6 42406324 missense possibly damaging 0.79
R1412:Tas2r135 UTSW 6 42405834 missense probably benign 0.00
R4629:Tas2r135 UTSW 6 42406226 missense probably benign 0.03
R5788:Tas2r135 UTSW 6 42405597 missense probably damaging 1.00
R6021:Tas2r135 UTSW 6 42406387 missense probably damaging 1.00
R6586:Tas2r135 UTSW 6 42406018 missense probably benign 0.18
R7180:Tas2r135 UTSW 6 42405751 nonsense probably null
R7458:Tas2r135 UTSW 6 42405947 missense possibly damaging 0.95
R7850:Tas2r135 UTSW 6 42406138 missense probably benign
R7933:Tas2r135 UTSW 6 42406138 missense probably benign
Z1176:Tas2r135 UTSW 6 42406234 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACTGCTGCAACCATCTGG -3'
(R):5'- TCCCGAAGTTCTGAAAGGGC -3'

Sequencing Primer
(F):5'- GCTGCAACCATCTGGCTCTG -3'
(R):5'- GGGCCAAGAAAGTCTTCTTCATG -3'
Posted On2015-08-18