Incidental Mutation 'R4517:Nr2f2'
ID332948
Institutional Source Beutler Lab
Gene Symbol Nr2f2
Ensembl Gene ENSMUSG00000030551
Gene Namenuclear receptor subfamily 2, group F, member 2
SynonymsTcfcoup2, COUP-TFII, COUP-TF2, ARP-1, EAR3, 9430015G03Rik, Aporp1
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location70351944-70366735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70358122 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 204 (N204T)
Ref Sequence ENSEMBL: ENSMUSP00000032768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032768] [ENSMUST00000089565] [ENSMUST00000208081]
Predicted Effect probably benign
Transcript: ENSMUST00000032768
AA Change: N204T

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032768
Gene: ENSMUSG00000030551
AA Change: N204T

DomainStartEndE-ValueType
low complexity region 21 75 N/A INTRINSIC
ZnF_C4 76 147 4.57e-39 SMART
HOLI 214 374 1.29e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089565
AA Change: N71T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000086993
Gene: ENSMUSG00000030551
AA Change: N71T

DomainStartEndE-ValueType
HOLI 81 241 5.2e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207153
Predicted Effect probably benign
Transcript: ENSMUST00000208081
AA Change: N51T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208681
Meta Mutation Damage Score 0.0953 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid thyroid hormone superfamily of nuclear receptors. The encoded protein is a ligand inducible transcription factor that is involved in the regulation of many different genes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired angiogenesis and heart development with hemorrhagic brains and hearts, and die around embryonic day 10. About 5% of heterozygotes share the hemorrhagic phenotype at embryonic day 9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Nr2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Nr2f2 APN 7 70357766 missense possibly damaging 0.88
IGL01736:Nr2f2 APN 7 70354698 missense probably damaging 1.00
IGL02667:Nr2f2 APN 7 70357985 missense probably damaging 1.00
R0149:Nr2f2 UTSW 7 70358062 missense possibly damaging 0.90
R0206:Nr2f2 UTSW 7 70360175 missense probably damaging 0.98
R0207:Nr2f2 UTSW 7 70360175 missense probably damaging 0.98
R0240:Nr2f2 UTSW 7 70360175 missense probably damaging 0.98
R0243:Nr2f2 UTSW 7 70360175 missense probably damaging 0.98
R0361:Nr2f2 UTSW 7 70358062 missense possibly damaging 0.90
R0540:Nr2f2 UTSW 7 70354712 missense probably damaging 1.00
R0607:Nr2f2 UTSW 7 70354712 missense probably damaging 1.00
R0741:Nr2f2 UTSW 7 70357997 missense probably damaging 1.00
R1894:Nr2f2 UTSW 7 70354671 missense probably benign 0.00
R1961:Nr2f2 UTSW 7 70358155 missense possibly damaging 0.80
R3033:Nr2f2 UTSW 7 70358062 missense possibly damaging 0.90
R3754:Nr2f2 UTSW 7 70358021 missense probably benign 0.01
R6175:Nr2f2 UTSW 7 70358198 missense probably damaging 1.00
R6226:Nr2f2 UTSW 7 70359996 missense probably benign 0.00
R7544:Nr2f2 UTSW 7 70354751 missense probably damaging 1.00
R7796:Nr2f2 UTSW 7 70358153 missense probably benign 0.03
R7894:Nr2f2 UTSW 7 70359933 missense probably damaging 1.00
R7977:Nr2f2 UTSW 7 70359933 missense probably damaging 1.00
Z1176:Nr2f2 UTSW 7 70357778 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGGTCCATAAAAGCGACC -3'
(R):5'- TCCTGCAGCTGTACAGAGAG -3'

Sequencing Primer
(F):5'- CTGACATGGGTGAAGCGTGC -3'
(R):5'- CTGTACAGAGAGGCAGGATGC -3'
Posted On2015-08-18