Incidental Mutation 'R4517:Pcf11'
ID332949
Institutional Source Beutler Lab
Gene Symbol Pcf11
Ensembl Gene ENSMUSG00000041328
Gene NamePCF11 cleavage and polyadenylation factor subunit
Synonyms2500001H09Rik, 5730417B17Rik
MMRRC Submission 041761-MU
Accession Numbers

Genbank: NM_029078; MGI: 1919579

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location92643543-92669934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92646488 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1451 (Y1451C)
Ref Sequence ENSEMBL: ENSMUSP00000113717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119954]
Predicted Effect probably damaging
Transcript: ENSMUST00000119954
AA Change: Y1451C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113717
Gene: ENSMUSG00000041328
AA Change: Y1451C

DomainStartEndE-ValueType
RPR 17 139 6.74e-43 SMART
low complexity region 173 194 N/A INTRINSIC
coiled coil region 202 243 N/A INTRINSIC
low complexity region 355 380 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
low complexity region 471 513 N/A INTRINSIC
low complexity region 793 819 N/A INTRINSIC
low complexity region 833 853 N/A INTRINSIC
internal_repeat_1 854 931 1.77e-14 PROSPERO
low complexity region 932 948 N/A INTRINSIC
internal_repeat_1 969 1105 1.77e-14 PROSPERO
low complexity region 1159 1178 N/A INTRINSIC
low complexity region 1294 1315 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148539
Predicted Effect unknown
Transcript: ENSMUST00000151177
AA Change: Y1373C
SMART Domains Protein: ENSMUSP00000115278
Gene: ENSMUSG00000041328
AA Change: Y1373C

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 147 172 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 263 305 N/A INTRINSIC
low complexity region 716 742 N/A INTRINSIC
low complexity region 756 776 N/A INTRINSIC
internal_repeat_1 777 854 3.34e-13 PROSPERO
low complexity region 855 871 N/A INTRINSIC
internal_repeat_1 892 1028 3.34e-13 PROSPERO
low complexity region 1082 1101 N/A INTRINSIC
low complexity region 1217 1238 N/A INTRINSIC
low complexity region 1368 1381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192772
Meta Mutation Damage Score 0.2960 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to CLP1 to form pre-mRNA cleavage factor IIm. The encoded protein is necessary for efficient Pol II transcription termination and may be involved in degradation of the 3' product of polyA site cleavage. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Pcf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Pcf11 APN 7 92661686 missense possibly damaging 0.51
IGL02439:Pcf11 APN 7 92661841 missense possibly damaging 0.93
IGL02658:Pcf11 APN 7 92647046 missense probably damaging 1.00
IGL02702:Pcf11 APN 7 92661618 missense possibly damaging 0.76
3-1:Pcf11 UTSW 7 92658518 missense probably damaging 1.00
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0015:Pcf11 UTSW 7 92658317 missense probably benign 0.28
R0078:Pcf11 UTSW 7 92669559 missense possibly damaging 0.90
R0110:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R0373:Pcf11 UTSW 7 92661215 missense probably benign
R0450:Pcf11 UTSW 7 92657831 missense probably damaging 1.00
R1717:Pcf11 UTSW 7 92663585 missense probably benign 0.00
R1952:Pcf11 UTSW 7 92661338 missense probably damaging 1.00
R1965:Pcf11 UTSW 7 92661601 missense probably benign
R2045:Pcf11 UTSW 7 92661879 missense probably damaging 1.00
R2245:Pcf11 UTSW 7 92665872 unclassified probably benign
R3824:Pcf11 UTSW 7 92659620 intron probably benign
R4439:Pcf11 UTSW 7 92658017 missense probably damaging 0.99
R4671:Pcf11 UTSW 7 92657529 missense possibly damaging 0.62
R4674:Pcf11 UTSW 7 92659777 intron probably benign
R4675:Pcf11 UTSW 7 92659777 intron probably benign
R4732:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4733:Pcf11 UTSW 7 92658833 missense probably benign 0.33
R4758:Pcf11 UTSW 7 92661175 missense probably damaging 0.97
R4985:Pcf11 UTSW 7 92661902 missense probably benign 0.01
R5041:Pcf11 UTSW 7 92658405 missense probably benign 0.00
R5248:Pcf11 UTSW 7 92661491 missense probably damaging 1.00
R5688:Pcf11 UTSW 7 92658808 missense possibly damaging 0.92
R5814:Pcf11 UTSW 7 92657714 missense probably benign 0.00
R6240:Pcf11 UTSW 7 92646502 missense probably damaging 1.00
R6327:Pcf11 UTSW 7 92659609 intron probably benign
R6615:Pcf11 UTSW 7 92657882 missense probably damaging 0.96
R6795:Pcf11 UTSW 7 92657578 missense probably benign 0.04
R6896:Pcf11 UTSW 7 92649551 missense probably damaging 0.99
R6902:Pcf11 UTSW 7 92658299 missense probably damaging 0.99
R7030:Pcf11 UTSW 7 92657678 missense probably benign 0.21
R7135:Pcf11 UTSW 7 92657316 missense probably benign 0.05
R7162:Pcf11 UTSW 7 92664013 missense probably damaging 0.97
R7210:Pcf11 UTSW 7 92663476 missense probably benign
R7243:Pcf11 UTSW 7 92660060 missense probably damaging 1.00
R7362:Pcf11 UTSW 7 92653245 missense possibly damaging 0.83
R7876:Pcf11 UTSW 7 92661326 missense probably damaging 1.00
R7959:Pcf11 UTSW 7 92661326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTTGCTAGAATCCCTCCAAAG -3'
(R):5'- GGTTGGATGCCATCAGTGAC -3'

Sequencing Primer
(F):5'- GTTGCTAGAATCCCTCCAAAGGAAAC -3'
(R):5'- GGATGCCATCAGTGACTAATATAGTG -3'
Posted On2015-08-18