Incidental Mutation 'R4517:Echs1'
ID332951
Institutional Source Beutler Lab
Gene Symbol Echs1
Ensembl Gene ENSMUSG00000025465
Gene Nameenoyl Coenzyme A hydratase, short chain, 1, mitochondrial
Synonyms
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140105710-140116476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140112496 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000026538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026538] [ENSMUST00000211757]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026538
AA Change: S113P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026538
Gene: ENSMUSG00000025465
AA Change: S113P

DomainStartEndE-ValueType
Pfam:ECH_1 42 290 3.1e-104 PFAM
Pfam:ECH_2 47 223 3.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155647
Predicted Effect probably benign
Transcript: ENSMUST00000209908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211120
Predicted Effect probably benign
Transcript: ENSMUST00000211757
Meta Mutation Damage Score 0.0775 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions in the second step of the mitochondrial fatty acid beta-oxidation pathway. It catalyzes the hydration of 2-trans-enoyl-coenzyme A (CoA) intermediates to L-3-hydroxyacyl-CoAs. The gene product is a member of the hydratase/isomerase superfamily. It localizes to the mitochondrial matrix. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Echs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Echs1 APN 7 140111710 missense probably damaging 1.00
IGL03342:Echs1 APN 7 140110113 splice site probably benign
geistlische UTSW 7 140113069 missense possibly damaging 0.81
R2397:Echs1 UTSW 7 140112477 missense possibly damaging 0.86
R4723:Echs1 UTSW 7 140110648 splice site probably benign
R4858:Echs1 UTSW 7 140112586 unclassified probably benign
R5523:Echs1 UTSW 7 140112513 missense probably benign 0.01
R5747:Echs1 UTSW 7 140111812 unclassified probably benign
R6244:Echs1 UTSW 7 140113069 missense possibly damaging 0.81
R6474:Echs1 UTSW 7 140108142 missense probably benign 0.44
R6917:Echs1 UTSW 7 140110011 missense probably benign 0.00
R6943:Echs1 UTSW 7 140108094 missense probably damaging 0.99
R7761:Echs1 UTSW 7 140112465 missense probably damaging 1.00
R7826:Echs1 UTSW 7 140116436 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCACTAAGGCATCTGGGAACTC -3'
(R):5'- TGCCTGACACAGTCCTCAAC -3'

Sequencing Primer
(F):5'- ATCTGGGAACTCGCCAACG -3'
(R):5'- CCTTCTTAAAACAGATGGCTTGGTG -3'
Posted On2015-08-18