Incidental Mutation 'R4517:Olfr541'
ID332952
Institutional Source Beutler Lab
Gene Symbol Olfr541
Ensembl Gene ENSMUSG00000057997
Gene Nameolfactory receptor 541
SynonymsGA_x6K02T2PBJ9-42850324-42851256, MOR253-3
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140697267-140705606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140705091 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 280 (Y280C)
Ref Sequence ENSEMBL: ENSMUSP00000148238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080681] [ENSMUST00000209857] [ENSMUST00000210357]
Predicted Effect probably damaging
Transcript: ENSMUST00000080681
AA Change: Y280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079508
Gene: ENSMUSG00000057997
AA Change: Y280C

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 2.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 180 5e-8 PFAM
Pfam:7tm_1 43 292 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209857
Predicted Effect probably damaging
Transcript: ENSMUST00000210357
AA Change: Y280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Olfr541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr541 APN 7 140704437 missense probably damaging 1.00
IGL01872:Olfr541 APN 7 140704263 missense possibly damaging 0.59
IGL02814:Olfr541 APN 7 140705133 missense probably damaging 1.00
R0690:Olfr541 UTSW 7 140704787 missense possibly damaging 0.88
R1019:Olfr541 UTSW 7 140704494 missense probably damaging 1.00
R1665:Olfr541 UTSW 7 140704794 missense probably damaging 1.00
R1696:Olfr541 UTSW 7 140704496 nonsense probably null
R4065:Olfr541 UTSW 7 140704269 missense probably benign
R5549:Olfr541 UTSW 7 140704799 unclassified probably null
R6327:Olfr541 UTSW 7 140704703 missense probably damaging 1.00
R7288:Olfr541 UTSW 7 140705029 nonsense probably null
R7307:Olfr541 UTSW 7 140705147 missense probably benign 0.39
R7454:Olfr541 UTSW 7 140704634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCAACTTCGTGCTAACAC -3'
(R):5'- GATGGGTACACTTTGCTCCG -3'

Sequencing Primer
(F):5'- TATGGCTACATCATTGGCAGC -3'
(R):5'- GGTACACTTTGCTCCGTGAAGC -3'
Posted On2015-08-18