Incidental Mutation 'R4517:Cd209a'
ID332954
Institutional Source Beutler Lab
Gene Symbol Cd209a
Ensembl Gene ENSMUSG00000031494
Gene NameCD209a antigen
SynonymsCIRE, DC-SIGN1, CD209, DC-SIGN, SIGNR5, Dcsign
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3743397-3748984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3745525 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 123 (D123V)
Ref Sequence ENSEMBL: ENSMUSP00000146627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012847] [ENSMUST00000207979] [ENSMUST00000208960]
Predicted Effect probably damaging
Transcript: ENSMUST00000012847
AA Change: D182V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012847
Gene: ENSMUSG00000031494
AA Change: D182V

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
CLECT 108 229 2.79e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207906
Predicted Effect probably damaging
Transcript: ENSMUST00000207979
AA Change: D155V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208960
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9111 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as L-SIGN because of its expression in the endothelial cells of the lymph nodes and liver. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses, with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are common and have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 30835; often referred to as DC-SIGN or CD209). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to bacterial infection despite altered lymphocyte numbers and increased inflammatory response.. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Cd209a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Cd209a APN 8 3748851 splice site probably benign
IGL02216:Cd209a APN 8 3745576 missense probably damaging 1.00
R0306:Cd209a UTSW 8 3745535 missense probably benign
R0696:Cd209a UTSW 8 3748384 missense possibly damaging 0.65
R1818:Cd209a UTSW 8 3745576 missense probably damaging 0.99
R4994:Cd209a UTSW 8 3747713 critical splice acceptor site probably null
R5913:Cd209a UTSW 8 3748742 missense probably benign 0.00
R6475:Cd209a UTSW 8 3747031 missense probably damaging 0.99
R7372:Cd209a UTSW 8 3748857 splice site probably null
R7557:Cd209a UTSW 8 3745541 missense probably benign 0.11
R7570:Cd209a UTSW 8 3744151 missense probably damaging 1.00
Z1088:Cd209a UTSW 8 3747017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATCTCAGGCACCTATCTGC -3'
(R):5'- AGACCCAGAACTCATGGTATTC -3'

Sequencing Primer
(F):5'- ACCTATCTGCCATTCTATCTGGAC -3'
(R):5'- CATCAAATTATAGGTGGAACTTCCC -3'
Posted On2015-08-18