Incidental Mutation 'R4517:Mcu'
ID332956
Institutional Source Beutler Lab
Gene Symbol Mcu
Ensembl Gene ENSMUSG00000009647
Gene Namemitochondrial calcium uniporter
Synonyms2010012O16Rik, Ccdc109a, D130073L02Rik
MMRRC Submission 041761-MU
Accession Numbers

Genbank: NM_001033259; MGI: 3026965

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location59446984-59616692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59467634 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 127 (Y127C)
Ref Sequence ENSEMBL: ENSMUSP00000020312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020312]
Predicted Effect probably damaging
Transcript: ENSMUST00000020312
AA Change: Y127C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020312
Gene: ENSMUSG00000009647
AA Change: Y127C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
Pfam:MCU 114 319 3.5e-78 PFAM
Meta Mutation Damage Score 0.7254 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium transporter that localizes to the mitochondrial inner membrane. The encoded protein interacts with mitochondrial calcium uptake 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired calcium-induced permeability transition pore opening, decreased body size and weight, decreased exercise endurance and decreased grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Mcu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:Mcu APN 10 59467644 missense probably damaging 1.00
IGL03074:Mcu APN 10 59467758 missense probably damaging 0.99
R0201:Mcu UTSW 10 59456677 missense probably damaging 1.00
R0445:Mcu UTSW 10 59456645 splice site probably benign
R1256:Mcu UTSW 10 59454968 missense probably damaging 1.00
R1497:Mcu UTSW 10 59448848 missense probably damaging 1.00
R2322:Mcu UTSW 10 59454944 critical splice donor site probably null
R2404:Mcu UTSW 10 59467704 missense probably damaging 1.00
R4666:Mcu UTSW 10 59456699 missense probably damaging 1.00
R4821:Mcu UTSW 10 59467689 missense probably damaging 0.99
R5940:Mcu UTSW 10 59456732 missense possibly damaging 0.94
R6949:Mcu UTSW 10 59456744 missense possibly damaging 0.94
R8054:Mcu UTSW 10 59454995 missense probably damaging 1.00
RF007:Mcu UTSW 10 59491116 missense probably benign 0.00
Z1177:Mcu UTSW 10 59456771 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACATTCGATGTGAGCTGC -3'
(R):5'- TTTTCGCTCAGACGTGACG -3'

Sequencing Primer
(F):5'- AGCTGCTTTGGAATGAGACTCCC -3'
(R):5'- CAGACGTGACGGTGGTTTACC -3'
Posted On2015-08-18