Incidental Mutation 'R4517:Glod4'
ID332960
Institutional Source Beutler Lab
Gene Symbol Glod4
Ensembl Gene ENSMUSG00000017286
Gene Nameglyoxalase domain containing 4
Synonyms1700082G03Rik, 2700085E05Rik
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76120987-76243725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76243571 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 25 (D25V)
Ref Sequence ENSEMBL: ENSMUSP00000132496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017430] [ENSMUST00000040577] [ENSMUST00000168055] [ENSMUST00000169701] [ENSMUST00000170017] [ENSMUST00000170590] [ENSMUST00000170710]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017430
AA Change: D25V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017430
Gene: ENSMUSG00000017286
AA Change: D25V

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040577
SMART Domains Protein: ENSMUSP00000042882
Gene: ENSMUSG00000038046

DomainStartEndE-ValueType
SpoU_sub_bind 124 195 1.99e-5 SMART
Pfam:SpoU_methylase 209 398 2.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125463
Predicted Effect probably benign
Transcript: ENSMUST00000164022
SMART Domains Protein: ENSMUSP00000126699
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 2 212 1e-143 PDB
SCOP:d1mpya1 119 198 4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167883
Predicted Effect probably benign
Transcript: ENSMUST00000168055
SMART Domains Protein: ENSMUSP00000130675
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
PDB:3ZI1|A 2 98 3e-61 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect possibly damaging
Transcript: ENSMUST00000169701
AA Change: D25V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286
AA Change: D25V

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170017
AA Change: D25V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132496
Gene: ENSMUSG00000017286
AA Change: D25V

DomainStartEndE-ValueType
SCOP:d1qipa_ 1 40 3e-5 SMART
PDB:3ZI1|A 1 47 4e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000170590
AA Change: D25V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129009
Gene: ENSMUSG00000017286
AA Change: D25V

DomainStartEndE-ValueType
PDB:3ZI1|A 1 47 2e-23 PDB
SCOP:d1mpya2 1 66 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170710
SMART Domains Protein: ENSMUSP00000131788
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 124 237 6.1e-9 PFAM
Meta Mutation Damage Score 0.5838 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Glod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Glod4 APN 11 76233278 missense probably benign 0.08
IGL01099:Glod4 APN 11 76239550 nonsense probably null
IGL01761:Glod4 APN 11 76243602 missense probably benign 0.00
FR4548:Glod4 UTSW 11 76243310 start gained probably benign
R1354:Glod4 UTSW 11 76237828 splice site probably null
R1386:Glod4 UTSW 11 76222003 nonsense probably null
R1791:Glod4 UTSW 11 76237708 missense probably damaging 1.00
R2281:Glod4 UTSW 11 76237809 missense possibly damaging 0.74
R2484:Glod4 UTSW 11 76239518 missense probably damaging 1.00
R4515:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R4519:Glod4 UTSW 11 76243571 missense probably damaging 1.00
R5945:Glod4 UTSW 11 76234471 missense probably damaging 1.00
R6471:Glod4 UTSW 11 76233918 missense probably damaging 1.00
R6488:Glod4 UTSW 11 76237785 missense probably damaging 0.96
R6976:Glod4 UTSW 11 76243580 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAAGGCTTCCCAACCCG -3'
(R):5'- GAGGGAGACAACACTCTCAC -3'

Sequencing Primer
(F):5'- GCTTCCCAACCCGAAAGAGG -3'
(R):5'- CAGCAATGATCCCAGGGAGC -3'
Posted On2015-08-18