Incidental Mutation 'R4517:Gpc5'
ID332963
Institutional Source Beutler Lab
Gene Symbol Gpc5
Ensembl Gene ENSMUSG00000022112
Gene Nameglypican 5
SynonymsA230034F01Rik
MMRRC Submission 041761-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location115092215-116525179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115552239 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 508 (N508K)
Ref Sequence ENSEMBL: ENSMUSP00000135085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000176912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022707
AA Change: N435K

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: N435K

DomainStartEndE-ValueType
Pfam:Glypican 9 572 1.8e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176139
Predicted Effect possibly damaging
Transcript: ENSMUST00000176912
AA Change: N508K

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: N508K

DomainStartEndE-ValueType
Pfam:Glypican 85 642 1.6e-174 PFAM
Meta Mutation Damage Score 0.1369 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
B4galnt4 A G 7: 141,067,722 K408E probably damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in Gpc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Gpc5 APN 14 115370024 missense probably damaging 1.00
IGL01298:Gpc5 APN 14 115399188 missense probably benign 0.14
IGL01359:Gpc5 APN 14 115369750 missense possibly damaging 0.74
IGL02354:Gpc5 APN 14 115133287 nonsense probably null
IGL02361:Gpc5 APN 14 115133287 nonsense probably null
IGL02982:Gpc5 APN 14 115369988 missense probably damaging 1.00
IGL03120:Gpc5 APN 14 115370144 missense possibly damaging 0.64
R0322:Gpc5 UTSW 14 115399151 missense probably benign 0.05
R0396:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R0555:Gpc5 UTSW 14 115552328 missense probably damaging 0.98
R0629:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R1536:Gpc5 UTSW 14 115399250 missense probably benign 0.09
R1660:Gpc5 UTSW 14 115399279 missense probably benign 0.12
R1676:Gpc5 UTSW 14 115370098 missense probably damaging 1.00
R2328:Gpc5 UTSW 14 115788179 missense probably damaging 0.99
R3522:Gpc5 UTSW 14 116524335 missense probably benign 0.00
R3776:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3885:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3889:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3893:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R4041:Gpc5 UTSW 14 115133216 missense probably damaging 1.00
R5068:Gpc5 UTSW 14 115417264 makesense probably null
R5639:Gpc5 UTSW 14 115092747 missense probably benign 0.13
R5730:Gpc5 UTSW 14 115788314 missense possibly damaging 0.73
R5944:Gpc5 UTSW 14 115369838 missense probably benign 0.24
R6351:Gpc5 UTSW 14 115399200 missense probably benign 0.01
R6557:Gpc5 UTSW 14 115092534 unclassified probably benign
R6657:Gpc5 UTSW 14 115370198 missense probably benign 0.01
R6714:Gpc5 UTSW 14 115552303 nonsense probably null
R6751:Gpc5 UTSW 14 115369951 missense probably benign 0.00
R7057:Gpc5 UTSW 14 115133242 missense possibly damaging 0.64
R7142:Gpc5 UTSW 14 115417203 missense probably benign 0.01
R7225:Gpc5 UTSW 14 115552298 missense probably damaging 1.00
R7544:Gpc5 UTSW 14 115428173 missense probably damaging 1.00
R7658:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R7695:Gpc5 UTSW 14 115092594 missense unknown
R7785:Gpc5 UTSW 14 115417220 missense probably benign 0.00
R8116:Gpc5 UTSW 14 115399225 missense probably damaging 0.98
RF001:Gpc5 UTSW 14 115417178 missense probably benign 0.41
RF022:Gpc5 UTSW 14 115552276 missense probably damaging 1.00
Z1176:Gpc5 UTSW 14 115369964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGGATTATCCAAACACTGC -3'
(R):5'- GCATTCGCATACCATTGAAAGC -3'

Sequencing Primer
(F):5'- CATGTCACCTCAGTAGAAGGGCTG -3'
(R):5'- CTGGATGACATGCTTCAG -3'
Posted On2015-08-18